RchiOBHm_Chr5g0046271

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
42329023 .. 42330794
1772 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32428

Sequence Viewer

Length: 168 bp
ATGAGAATGAGGTATCATTTAATTGTGAAAGAAAGCTTTGGAGGAGAACATAATTGTGTATCTGGAAACTGGTTGTGGAAAGACCTAAATAGCCGTGTTGCTTATGAAGATCTTTGTGGTATATATGGATCAAATTGCTCCCAATGGATTATTGCAATGGAGTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.48

Weight (kDa)

6.01

Isoelectric Point (pI)

19.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 136
AluBI AGCT 1 cut(s) 36
AluI AGCT 1 cut(s) 36
AlwI GGATC 1 cut(s) 136
BceAI ACGGC 1 cut(s) 78
BglII AGATCT 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 162
BseMI GCAATG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 57
Bsp143I GATC 2 cut(s) 109, 128
BspPI GGATC 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 162
BsrI ACTGG 1 cut(s) 74
BssMI GATC 2 cut(s) 109, 128
BstKTI GATC 2 cut(s) 112, 131
BstMBI GATC 2 cut(s) 109, 128
BstX2I RGATCY 1 cut(s) 109
BstYI RGATCY 1 cut(s) 109
CviJI RGCY 2 cut(s) 36, 93
CviKI_1 RGCY 2 cut(s) 36, 93
DpnI GATC 2 cut(s) 111, 130
DpnII GATC 2 cut(s) 109, 128
FaiI YATR 5 cut(s) 51, 105, 122, 124, 126
HindIII AAGCTT 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 155
Kzo9I GATC 2 cut(s) 109, 128
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 2 cut(s) 48, 55
MalI GATC 2 cut(s) 111, 130
MboI GATC 2 cut(s) 109, 128
MboII GAAGA 1 cut(s) 119
MflI RGATCY 1 cut(s) 109
MluCI AATT 3 cut(s) 21, 52, 133
MnlI CCTC 2 cut(s) 3, 35
MseI TTAA 1 cut(s) 20
MslI CAYNNNNRTG 1 cut(s) 54
NdeII GATC 2 cut(s) 109, 128
PsuI RGATCY 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 54
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 2 cut(s) 109, 128
SetI ASST 3 cut(s) 14, 38, 87
SgeI CNNG 3 cut(s) 75, 82, 107
SmiMI CAYNNNNRTG 1 cut(s) 54
Sse9I AATT 3 cut(s) 21, 52, 133
TasI AATT 3 cut(s) 21, 52, 133
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.