Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0006958

Physical Location & Seq

Genomic Coordinates Forward (+)

42565190 .. 42566145

Gene Structure 956 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ32451

Sequence Viewer

CDS Protein Promoter (2k)

Length: 216 bp

ATGTATGAGCTTATTAGAGGTTCACCGTTACCGGAAGAAGGACCTCAAACCTTAAATCTTAAGAAAGGAAAATTGCCACTGCTTCCTGGTCACTCCTTGCAACTTCAGAACTTGCTCAAGGCCATGTTGGATCCAAATCCAGTCTGCAGACCATCAGCTAAAGAGTTGGTTGAAAATCTAATGTTCCACAGGGTGCTAAAAAATGCATGGGCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000075 GO:0000076 GO:0003674 GO:0003824 GO:0004672 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007049 GO:0007050 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0022402 GO:0031570 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0045786 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051726 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04110 map04110

Pfam Domains

Protein Families

Pkinase

Protein Analysis

71

Amino Acids

8.0

Weight (kDa)

9.36

Isoelectric Point (pI)

42.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006958)

Species	Orthologous Gene IDs
malus_domestica	MD11G1302700.v1.1
rosa_chinensis	RchiOBHm_Chr5g0045701 RchiOBHm_Chr5g0045731 RchiOBHm_Chr5g0045951 RchiOBHm_Chr5g0046271 RchiOBHm_Chr5g0046501 RchiOBHm_Chr5g0046521
rosa_multiflora	Rmu_sc0001035.1_g000079 Rmu_sc0003628.1_g000028
rosa_roxburghii	Rroxscaffold_1G00035460
rosa_rugosa	Rorug05G0224300
rosa_samantha	Rh5AG305900 Rh5AG306000 Rh5AG307000 Rh5AG307300 Rh5AG308200 Rh5AG308300 Rh5AG308500 Rh5AG308600 Rh5AG308700 Rh5AG308900
rosa_wichuraiana	Rw0G021490 Rw0G021570 Rw5G028580 Rw5G028770 Rw5G028870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	125, 138
AcuI	CTGAAG	1 cut(s)	89
AdeI	CACNNNGTG	1 cut(s)	193
AfiI	CCNNNNNNNGG	1 cut(s)	38
AflII	CTTAAG	1 cut(s)	59
AgsI	TTSAA	1 cut(s)	173
AjnI	CCWGG	1 cut(s)	85
AluBI	AGCT	2 cut(s)	10, 158
AluI	AGCT	2 cut(s)	10, 158
AlwI	GGATC	2 cut(s)	125, 138
AoxI	GGCC	2 cut(s)	120, 210
AspS9I	GGNCC	2 cut(s)	41, 210
AsuHPI	GGTGA	1 cut(s)	15
AvaII	GGWCC	1 cut(s)	41
BamHI	GGATCC	1 cut(s)	130
BccI	CCATC	1 cut(s)	160
BciT130I	CCWGG	1 cut(s)	87
BfaI	CTAG	1 cut(s)	214
BfmI	CTRYAG	1 cut(s)	145
BfrI	CTTAAG	1 cut(s)	59
Bme1390I	CCNGG	1 cut(s)	87
Bme18I	GGWCC	1 cut(s)	41
BmgT120I	GGNCC	2 cut(s)	41, 210
BmiI	GGNNCC	1 cut(s)	132
BmrFI	CCNGG	1 cut(s)	87
BpuEI	CTTGAG	1 cut(s)	101
BsaBI	GATNNNNATC	1 cut(s)	135
BsaWI	WCCGGW	1 cut(s)	31
Bsc4I	CCNNNNNNNGG	1 cut(s)	38
Bse1I	ACTGG	1 cut(s)	140
Bse8I	GATNNNNATC	1 cut(s)	135
BseBI	CCWGG	1 cut(s)	87
BseJI	GATNNNNATC	1 cut(s)	135
BseLI	CCNNNNNNNGG	1 cut(s)	38
BseNI	ACTGG	1 cut(s)	140
BshFI	GGCC	2 cut(s)	122, 212
BsiSI	CCGG	1 cut(s)	32
BslI	CCNNNNNNNGG	1 cut(s)	38
BsnI	GGCC	2 cut(s)	122, 212
Bsp143I	GATC	1 cut(s)	130
BspANI	GGCC	2 cut(s)	122, 212
BspLI	GGNNCC	1 cut(s)	132
BspMAI	CTGCAG	1 cut(s)	149
BspPI	GGATC	2 cut(s)	125, 138
BspTI	CTTAAG	1 cut(s)	59
BsrI	ACTGG	1 cut(s)	140
BssMI	GATC	1 cut(s)	130
Bst2UI	CCWGG	1 cut(s)	87
Bst4CI	ACNGT	1 cut(s)	27
BstAFI	CTTAAG	1 cut(s)	59
BstKTI	GATC	1 cut(s)	133
BstMBI	GATC	1 cut(s)	130
BstNI	CCWGG	1 cut(s)	87
BstSCI	CCNGG	1 cut(s)	85
BstSFI	CTRYAG	1 cut(s)	145
BstX2I	RGATCY	1 cut(s)	130
BstYI	RGATCY	1 cut(s)	130
BsuRI	GGCC	2 cut(s)	122, 212
BtsI	GCAGTG	1 cut(s)	77
BtsIMutI	CAGTG	1 cut(s)	77
Cfr13I	GGNCC	2 cut(s)	41, 210
CviAII	CATG	2 cut(s)	124, 207
CviJI	RGCY	4 cut(s)	10, 122, 158, 212
CviKI_1	RGCY	4 cut(s)	10, 122, 158, 212
DpnI	GATC	1 cut(s)	132
DpnII	GATC	1 cut(s)	130
DraIII	CACNNNGTG	1 cut(s)	193
Eco47I	GGWCC	1 cut(s)	41
Eco57I	CTGAAG	1 cut(s)	89
EcoO109I	RGGNCCY	1 cut(s)	41
EcoRII	CCWGG	1 cut(s)	85
EcoT22I	ATGCAT	1 cut(s)	208
FaeI	CATG	2 cut(s)	127, 210
FaiI	YATR	3 cut(s)	6, 125, 208
FatI	CATG	2 cut(s)	123, 206
FspBI	CTAG	1 cut(s)	214
HaeIII	GGCC	2 cut(s)	122, 212
HapII	CCGG	1 cut(s)	32
Hin1II	CATG	2 cut(s)	127, 210
HpaII	CCGG	1 cut(s)	32
HphI	GGTGA	1 cut(s)	15
Hpy166II	GTNNAC	1 cut(s)	23
Hpy188I	TCNGA	1 cut(s)	108
Hpy8I	GTNNAC	1 cut(s)	23
HpyAV	CCTTC	1 cut(s)	32
HpyCH4III	ACNGT	1 cut(s)	27
HpyCH4V	TGCA	3 cut(s)	100, 147, 206
Hsp92II	CATG	2 cut(s)	127, 210
Kzo9I	GATC	1 cut(s)	130
LpnPI	CCDG	5 cut(s)	45, 72, 99, 153, 175
MaeI	CTAG	1 cut(s)	214
MaeIII	GTNAC	2 cut(s)	27, 89
MalI	GATC	1 cut(s)	132
MboI	GATC	1 cut(s)	130
MboII	GAAGA	1 cut(s)	47
MflI	RGATCY	1 cut(s)	130
MluCI	AATT	1 cut(s)	71
MmeI	TCCRAC	1 cut(s)	108
MnlI	CCTC	2 cut(s)	11, 54
Mph1103I	ATGCAT	1 cut(s)	208
MseI	TTAA	2 cut(s)	53, 60
MspCI	CTTAAG	1 cut(s)	59
MspI	CCGG	1 cut(s)	32
MspR9I	CCNGG	1 cut(s)	87
MvaI	CCWGG	1 cut(s)	87
NdeII	GATC	1 cut(s)	130
NlaIII	CATG	2 cut(s)	127, 210
NlaIV	GGNNCC	1 cut(s)	132
NmuCI	GTSAC	1 cut(s)	89
NsiI	ATGCAT	1 cut(s)	208
PpuMI	RGGWCCY	1 cut(s)	41
Psp5II	RGGWCCY	1 cut(s)	41
Psp6I	CCWGG	1 cut(s)	85
PspGI	CCWGG	1 cut(s)	85
PspN4I	GGNNCC	1 cut(s)	132
PspPI	GGNCC	2 cut(s)	41, 210
PspPPI	RGGWCCY	1 cut(s)	41
PstI	CTGCAG	1 cut(s)	149
PsuI	RGATCY	1 cut(s)	130
SaqAI	TTAA	2 cut(s)	53, 60
Sau3AI	GATC	1 cut(s)	130
Sau96I	GGNCC	2 cut(s)	41, 210
ScrFI	CCNGG	1 cut(s)	87
SetI	ASST	5 cut(s)	12, 22, 46, 53, 160
SfcI	CTRYAG	1 cut(s)	145
SgeI	CNNG	9 cut(s)	44, 98, 99, 109, 124, 130, 136, 152, 202
SinI	GGWCC	1 cut(s)	41
SmlI	CTYRAG	2 cut(s)	59, 116
SmoI	CTYRAG	2 cut(s)	59, 116
Sse9I	AATT	1 cut(s)	71
SspMI	CTAG	1 cut(s)	214
StyD4I	CCNGG	1 cut(s)	85
TaaI	ACNGT	1 cut(s)	27
TasI	AATT	1 cut(s)	71
Tru1I	TTAA	2 cut(s)	53, 60
Tru9I	TTAA	2 cut(s)	53, 60
TscAI	CASTG	1 cut(s)	84
TseFI	GTSAC	1 cut(s)	89
Tsp45I	GTSAC	1 cut(s)	89
TspRI	CASTG	1 cut(s)	84
Vha464I	CTTAAG	1 cut(s)	59
VpaK11BI	GGWCC	1 cut(s)	41
XspI	CTAG	1 cut(s)	214
Zsp2I	ATGCAT	1 cut(s)	208

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.