Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001035.1

Orthogroup ID

OG0006958

Physical Location & Seq

Genomic Coordinates Reverse (-)

384775 .. 385526

Gene Structure 752 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001035.1_g000079.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atgccttcagagatcctgaatgagaaacgtgacgatcttgacaaggctgatatcttctcattgggagttgctatgtatgagcttattagaggttcaccgttaccggaagaaggacctcaaaccttaaatcttaagaaaggaaaattgccactgcttcctggtcactccttgcaacttcagaacttgctcaaggccatgttggatccaaatccagtctgcagaccatcagctaaagagttggttgaaaatccaatgcatgggcctaggacaaccacgattgcgaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000075 GO:0000076 GO:0003674 GO:0003824 GO:0004672 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007049 GO:0007050 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0022402 GO:0031570 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0045786 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051726 GO:0065007 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04110 map04110

Pfam Domains

Protein Families

Pkinase

Protein Analysis

95

Amino Acids

10.47

Weight (kDa)

6.07

Isoelectric Point (pI)

54.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006958)

Species	Orthologous Gene IDs
malus_domestica	MD11G1302700.v1.1
rosa_chinensis	RchiOBHm_Chr5g0045701 RchiOBHm_Chr5g0045731 RchiOBHm_Chr5g0045951 RchiOBHm_Chr5g0046271 RchiOBHm_Chr5g0046501 RchiOBHm_Chr5g0046521
rosa_multiflora	Rmu_sc0001035.1_g000079 Rmu_sc0003628.1_g000028
rosa_roxburghii	Rroxscaffold_1G00035460
rosa_rugosa	Rorug05G0224300
rosa_samantha	Rh5AG305900 Rh5AG306000 Rh5AG307000 Rh5AG307300 Rh5AG308200 Rh5AG308300 Rh5AG308500 Rh5AG308600 Rh5AG308700 Rh5AG308900
rosa_wichuraiana	Rw0G021490 Rw0G021570 Rw5G028580 Rw5G028770 Rw5G028870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	257
AclWI	GGATC	3 cut(s)	7, 197, 210
AcuI	CTGAAG	1 cut(s)	161
AfiI	CCNNNNNNNGG	2 cut(s)	110, 257
AflII	CTTAAG	1 cut(s)	131
AgsI	TTSAA	1 cut(s)	245
AjnI	CCWGG	1 cut(s)	157
AluBI	AGCT	2 cut(s)	82, 230
AluI	AGCT	2 cut(s)	82, 230
AlwI	GGATC	3 cut(s)	7, 197, 210
AoxI	GGCC	2 cut(s)	192, 260
AspA2I	CCTAGG	1 cut(s)	263
AspS9I	GGNCC	2 cut(s)	113, 260
AsuHPI	GGTGA	1 cut(s)	87
AvaII	GGWCC	1 cut(s)	113
AvrII	CCTAGG	1 cut(s)	263
BamHI	GGATCC	1 cut(s)	202
BccI	CCATC	1 cut(s)	232
BciT130I	CCWGG	1 cut(s)	159
BfaI	CTAG	1 cut(s)	264
BfmI	CTRYAG	1 cut(s)	217
BfrI	CTTAAG	1 cut(s)	131
BlnI	CCTAGG	1 cut(s)	263
Bme1390I	CCNGG	1 cut(s)	159
Bme18I	GGWCC	1 cut(s)	113
BmgT120I	GGNCC	2 cut(s)	113, 260
BmiI	GGNNCC	1 cut(s)	204
BmrFI	CCNGG	1 cut(s)	159
BpuEI	CTTGAG	1 cut(s)	173
BsaBI	GATNNNNATC	1 cut(s)	207
BsaJI	CCNNGG	1 cut(s)	263
BsaWI	WCCGGW	1 cut(s)	103
Bsc4I	CCNNNNNNNGG	2 cut(s)	110, 257
Bse1I	ACTGG	1 cut(s)	212
Bse8I	GATNNNNATC	1 cut(s)	207
BseBI	CCWGG	1 cut(s)	159
BseDI	CCNNGG	1 cut(s)	263
BseJI	GATNNNNATC	1 cut(s)	207
BseLI	CCNNNNNNNGG	2 cut(s)	110, 257
BseNI	ACTGG	1 cut(s)	212
BshFI	GGCC	2 cut(s)	194, 262
BsiSI	CCGG	1 cut(s)	104
BslI	CCNNNNNNNGG	2 cut(s)	110, 257
BsnI	GGCC	2 cut(s)	194, 262
Bsp143I	GATC	3 cut(s)	12, 34, 202
BspANI	GGCC	2 cut(s)	194, 262
BspLI	GGNNCC	1 cut(s)	204
BspMAI	CTGCAG	1 cut(s)	221
BspPI	GGATC	3 cut(s)	7, 197, 210
BspTI	CTTAAG	1 cut(s)	131
BsrI	ACTGG	1 cut(s)	212
BssECI	CCNNGG	1 cut(s)	263
BssMI	GATC	3 cut(s)	12, 34, 202
BssT1I	CCWWGG	1 cut(s)	263
Bst2UI	CCWGG	1 cut(s)	159
Bst4CI	ACNGT	1 cut(s)	99
BstAFI	CTTAAG	1 cut(s)	131
BstKTI	GATC	3 cut(s)	15, 37, 205
BstMBI	GATC	3 cut(s)	12, 34, 202
BstNI	CCWGG	1 cut(s)	159
BstSCI	CCNGG	1 cut(s)	157
BstSFI	CTRYAG	1 cut(s)	217
BstX2I	RGATCY	2 cut(s)	12, 202
BstYI	RGATCY	2 cut(s)	12, 202
BsuRI	GGCC	2 cut(s)	194, 262
BtsI	GCAGTG	1 cut(s)	149
BtsIMutI	CAGTG	1 cut(s)	149
Cfr13I	GGNCC	2 cut(s)	113, 260
CviAII	CATG	2 cut(s)	196, 257
CviJI	RGCY	5 cut(s)	47, 82, 194, 230, 262
CviKI_1	RGCY	5 cut(s)	47, 82, 194, 230, 262
DpnI	GATC	3 cut(s)	14, 36, 204
DpnII	GATC	3 cut(s)	12, 34, 202
Eco130I	CCWWGG	1 cut(s)	263
Eco32I	GATATC	1 cut(s)	52
Eco47I	GGWCC	1 cut(s)	113
Eco57I	CTGAAG	1 cut(s)	161
EcoO109I	RGGNCCY	1 cut(s)	113
EcoRII	CCWGG	1 cut(s)	157
EcoRV	GATATC	1 cut(s)	52
EcoT14I	CCWWGG	1 cut(s)	263
EcoT22I	ATGCAT	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	263
FaeI	CATG	2 cut(s)	199, 260
FaiI	YATR	4 cut(s)	74, 78, 197, 258
FatI	CATG	2 cut(s)	195, 256
FspBI	CTAG	1 cut(s)	264
HaeIII	GGCC	2 cut(s)	194, 262
HapII	CCGG	1 cut(s)	104
Hin1II	CATG	2 cut(s)	199, 260
HpaII	CCGG	1 cut(s)	104
HphI	GGTGA	1 cut(s)	87
Hpy166II	GTNNAC	1 cut(s)	95
Hpy188I	TCNGA	2 cut(s)	10, 180
Hpy188III	TCNNGA	2 cut(s)	16, 38
Hpy8I	GTNNAC	1 cut(s)	95
HpyAV	CCTTC	2 cut(s)	15, 104
HpyCH4III	ACNGT	1 cut(s)	99
HpyCH4IV	ACGT	1 cut(s)	28
HpyCH4V	TGCA	3 cut(s)	172, 219, 256
HpySE526I	ACGT	1 cut(s)	28
Hsp92II	CATG	2 cut(s)	199, 260
Kzo9I	GATC	3 cut(s)	12, 34, 202
LpnPI	CCDG	5 cut(s)	29, 117, 144, 171, 225
MaeI	CTAG	1 cut(s)	264
MaeII	ACGT	1 cut(s)	28
MaeIII	GTNAC	3 cut(s)	29, 99, 161
MalI	GATC	3 cut(s)	14, 36, 204
MboI	GATC	3 cut(s)	12, 34, 202
MboII	GAAGA	2 cut(s)	46, 119
MflI	RGATCY	2 cut(s)	12, 202
MluCI	AATT	2 cut(s)	143, 283
MmeI	TCCRAC	1 cut(s)	180
MnlI	CCTC	2 cut(s)	83, 126
Mph1103I	ATGCAT	1 cut(s)	258
MseI	TTAA	2 cut(s)	125, 132
MspCI	CTTAAG	1 cut(s)	131
MspI	CCGG	1 cut(s)	104
MspR9I	CCNGG	1 cut(s)	159
MvaI	CCWGG	1 cut(s)	159
NdeII	GATC	3 cut(s)	12, 34, 202
NlaIII	CATG	2 cut(s)	199, 260
NlaIV	GGNNCC	1 cut(s)	204
NmuCI	GTSAC	2 cut(s)	29, 161
NsiI	ATGCAT	1 cut(s)	258
PflMI	CCANNNNNTGG	1 cut(s)	257
PpuMI	RGGWCCY	1 cut(s)	113
Psp5II	RGGWCCY	1 cut(s)	113
Psp6I	CCWGG	1 cut(s)	157
PspGI	CCWGG	1 cut(s)	157
PspN4I	GGNNCC	1 cut(s)	204
PspPI	GGNCC	2 cut(s)	113, 260
PspPPI	RGGWCCY	1 cut(s)	113
PstI	CTGCAG	1 cut(s)	221
PsuI	RGATCY	2 cut(s)	12, 202
SaqAI	TTAA	2 cut(s)	125, 132
Sau3AI	GATC	3 cut(s)	12, 34, 202
Sau96I	GGNCC	2 cut(s)	113, 260
ScrFI	CCNGG	1 cut(s)	159
SetI	ASST	6 cut(s)	31, 84, 94, 118, 125, 232
SfcI	CTRYAG	1 cut(s)	217
SinI	GGWCC	1 cut(s)	113
SmlI	CTYRAG	2 cut(s)	131, 188
SmoI	CTYRAG	2 cut(s)	131, 188
Sse9I	AATT	2 cut(s)	143, 283
SspMI	CTAG	1 cut(s)	264
StyD4I	CCNGG	1 cut(s)	157
StyI	CCWWGG	1 cut(s)	263
TaaI	ACNGT	1 cut(s)	99
TaiI	ACGT	1 cut(s)	31
TasI	AATT	2 cut(s)	143, 283
Tru1I	TTAA	2 cut(s)	125, 132
Tru9I	TTAA	2 cut(s)	125, 132
TscAI	CASTG	1 cut(s)	156
TseFI	GTSAC	2 cut(s)	29, 161
Tsp45I	GTSAC	2 cut(s)	29, 161
TspRI	CASTG	1 cut(s)	156
Van91I	CCANNNNNTGG	1 cut(s)	257
Vha464I	CTTAAG	1 cut(s)	131
VpaK11BI	GGWCC	1 cut(s)	113
XmaJI	CCTAGG	1 cut(s)	263
XspI	CTAG	1 cut(s)	264
Zsp2I	ATGCAT	1 cut(s)	258

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.