RchiOBHm_Chr5g0046501

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
42563638 .. 42564276
639 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32449

Sequence Viewer

Length: 150 bp
ATGAATGTTGCAAGAAGAACTGAGTTAGTTCAAGCTATTGCAAATAAACTTTTCAATTGGCCTTCGACTAAGGACTCTTTGCTTCGTCTACGGCTGGGAATTTCATCTGCTTTCATTTTTCTTAAGCCCCATCAAAGTAACAATCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.61

Weight (kDa)

11.57

Isoelectric Point (pI)

50.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 88
AcsI RAATTY 1 cut(s) 99
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 2 cut(s) 32, 55
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AoxI GGCC 1 cut(s) 59
ApoI RAATTY 1 cut(s) 99
BccI CCATC 1 cut(s) 138
BceAI ACGGC 1 cut(s) 107
BfrI CTTAAG 1 cut(s) 122
BseMII CTCAG 1 cut(s) 12
BseYI CCCAGC 1 cut(s) 94
BshFI GGCC 1 cut(s) 61
BsnI GGCC 1 cut(s) 61
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 13
BspTI CTTAAG 1 cut(s) 122
BstAFI CTTAAG 1 cut(s) 122
BstDEI CTNAG 2 cut(s) 21, 69
BsuRI GGCC 1 cut(s) 61
CviJI RGCY 4 cut(s) 35, 61, 94, 127
CviKI_1 RGCY 4 cut(s) 35, 61, 94, 127
DdeI CTNAG 2 cut(s) 21, 69
FblI GTMKAC 1 cut(s) 88
FspEI CC 9 cut(s) 43, 56, 75, 76, 80, 81, 141, 142, 143
GsaI CCCAGC 1 cut(s) 98
HaeIII GGCC 1 cut(s) 61
HinfI GANTC 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 89
Hpy8I GTNNAC 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 72
HpyCH4V TGCA 2 cut(s) 11, 41
HpyF3I CTNAG 2 cut(s) 21, 69
LpnPI CCDG 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 137
MboII GAAGA 1 cut(s) 27
MfeI CAATTG 1 cut(s) 55
MluCI AATT 2 cut(s) 55, 99
MlyI GAGTC 1 cut(s) 68
MseI TTAA 2 cut(s) 123, 148
MspCI CTTAAG 1 cut(s) 122
MunI CAATTG 1 cut(s) 55
PleI GAGTC 1 cut(s) 68
PpsI GAGTC 1 cut(s) 68
PspFI CCCAGC 1 cut(s) 94
SaqAI TTAA 2 cut(s) 123, 148
SchI GAGTC 1 cut(s) 68
SetI ASST 1 cut(s) 37
SgeI CNNG 3 cut(s) 24, 44, 107
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 2 cut(s) 55, 99
TaqI TCGA 1 cut(s) 65
TasI AATT 2 cut(s) 55, 99
Tru1I TTAA 2 cut(s) 123, 148
Tru9I TTAA 2 cut(s) 123, 148
TspDTI ATGAA 3 cut(s) 17, 93, 103
Vha464I CTTAAG 1 cut(s) 122
XapI RAATTY 1 cut(s) 99
XmiI GTMKAC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.