Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0003611

Physical Location & Seq

Genomic Coordinates Forward (+)

59548329 .. 59549544

Gene Structure 1216 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ33307

Sequence Viewer

CDS Protein Promoter (2k)

Length: 471 bp

ATGTCCCAGAAGGAAAAAACTCTTGACGAATTTGTACGGGATAAATGGCTTTCCTTCACTGCTGAGGATCATGTTGGACTTGGTGTCAGATCTTTCCTTGATCTGCTAATTTGGTTCCGCAATAATGATGTTCCTTCATGCGAAGTGTGTAACGAAGCTGGAGTGAAGAAAGAGGGTTGTATGTTTCGAATTCATCAGTACTGCCTTGGAAAACTGTGTGCTAAGAAAAAGGGTGAAAGAGTTTGTCCAAGTTGTGGTACTCAATGGCAATATACAGGACCAAAAGCAGAAGCAGTAGAAGATGATGAGCCAAATTGCGCCACTCAGAGCCAACCACCTGTGGAATCCAAGAGAAAGAAGCTGAGAACAAGCCGAATTGGTGATGGATATATAATTGAATCTAGTTCCTCTCAGGCTTCCTTACCTGATCGTAATCTGAGAAGATCCACTCGAAATTCCACCCGCCTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SMC_Nse1 zf-RING-like

Protein Analysis

156

Amino Acids

17.71

Weight (kDa)

8.79

Isoelectric Point (pI)

59.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003611)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G21140
fragaria_vesca	FvH4_3g30540 FvH4_3g30540 FvH4_3g30540 FvH4_3g30540
malus_domestica	MD11G1180700.v1.1
prunus_persica	Prupe.6G153500_v2.0.a1
pyrus_communis	pycom11g15590
rosa_chinensis	RchiOBHm_Chr5g0056151 RchiOBHm_Chr5g0056531 RchiOBHm_Chr6g0256561
rosa_laevigata	RLG00000035103
rosa_multiflora	Rmu_sc0000366.1_g000003 Rmu_sc0000366.1_g000039 Rmu_sc0001787.1_g000001 Rmu_sc0002204.1_g000004 Rmu_sc0004101.1_g000056 Rmu_sc0004174.1_g000007 Rmu_sc0004368.1_g000013 Rmu_sc0027729.1_g000001
rosa_roxburghii	Rroxscaffold_1G00023800
rosa_rugosa	Rorug05G0300600
rosa_samantha	Rh1BG210900 Rh1DG237500 Rh5AG370900 Rh5AG477300 Rh5BG382100 Rh5BG497800 Rh5CG324300 Rh5CG405300 Rh5DG395000
rosa_wichuraiana	Rw0G022130 Rw1G009200 Rw2G024960 Rw5G034750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	254
AciI	CCGC	2 cut(s)	118, 463
AclWI	GGATC	2 cut(s)	75, 438
AcsI	RAATTY	3 cut(s)	29, 189, 454
AfaI	GTAC	3 cut(s)	36, 200, 259
AfiI	CCNNNNNNNGG	1 cut(s)	254
AgsI	TTSAA	1 cut(s)	398
AhdI	GACNNNNNGTC	1 cut(s)	83
AluBI	AGCT	2 cut(s)	158, 361
AluI	AGCT	2 cut(s)	158, 361
AlwI	GGATC	2 cut(s)	75, 438
ApoI	RAATTY	3 cut(s)	29, 189, 454
AspLEI	GCGC	1 cut(s)	320
AspS9I	GGNCC	1 cut(s)	278
AsuHPI	GGTGA	2 cut(s)	245, 392
AsuII	TTCGAA	1 cut(s)	187
AvaII	GGWCC	1 cut(s)	278
BbvCI	CCTCAGC	1 cut(s)	63
BccI	CCATC	1 cut(s)	377
BfaI	CTAG	1 cut(s)	402
BglII	AGATCT	1 cut(s)	89
BmcAI	AGTACT	1 cut(s)	200
Bme18I	GGWCC	1 cut(s)	278
BmeRI	GACNNNNNGTC	1 cut(s)	83
BmgT120I	GGNCC	1 cut(s)	278
BmiI	GGNNCC	1 cut(s)	116
BpmI	CTGGAG	1 cut(s)	180
Bpu10I	CCTNAGC	1 cut(s)	63
Bpu14I	TTCGAA	1 cut(s)	187
BsaBI	GATNNNNATC	1 cut(s)	432
BsaJI	CCNNGG	1 cut(s)	205
Bsc4I	CCNNNNNNNGG	1 cut(s)	254
Bse8I	GATNNNNATC	1 cut(s)	432
BseDI	CCNNGG	1 cut(s)	205
BseJI	GATNNNNATC	1 cut(s)	432
BseLI	CCNNNNNNNGG	1 cut(s)	254
BseMII	CTCAG	5 cut(s)	54, 338, 353, 425, 428
BslI	CCNNNNNNNGG	1 cut(s)	254
Bsp119I	TTCGAA	1 cut(s)	187
Bsp143I	GATC	5 cut(s)	67, 89, 100, 427, 443
BspACI	CCGC	2 cut(s)	118, 463
BspCNI	CTCAG	5 cut(s)	55, 337, 354, 424, 429
BspLI	GGNNCC	1 cut(s)	116
BspPI	GGATC	2 cut(s)	75, 438
BspT104I	TTCGAA	1 cut(s)	187
BssECI	CCNNGG	1 cut(s)	205
BssMI	GATC	5 cut(s)	67, 89, 100, 427, 443
BssT1I	CCWWGG	1 cut(s)	205
Bst4CI	ACNGT	1 cut(s)	216
BstBI	TTCGAA	1 cut(s)	187
BstDEI	CTNAG	6 cut(s)	63, 222, 324, 362, 411, 437
BstHHI	GCGC	1 cut(s)	320
BstKTI	GATC	5 cut(s)	70, 92, 103, 430, 446
BstMBI	GATC	5 cut(s)	67, 89, 100, 427, 443
BstX2I	RGATCY	2 cut(s)	89, 443
BstYI	RGATCY	2 cut(s)	89, 443
BtsI	GCAGTG	1 cut(s)	57
BtsIMutI	CAGTG	1 cut(s)	57
CfoI	GCGC	1 cut(s)	320
Cfr13I	GGNCC	1 cut(s)	278
Csp6I	GTAC	3 cut(s)	35, 199, 258
CviAII	CATG	2 cut(s)	71, 138
CviJI	RGCY	7 cut(s)	49, 158, 310, 330, 361, 372, 416
CviKI_1	RGCY	7 cut(s)	49, 158, 310, 330, 361, 372, 416
CviQI	GTAC	3 cut(s)	35, 199, 258
DdeI	CTNAG	6 cut(s)	63, 222, 324, 362, 411, 437
DpnI	GATC	5 cut(s)	69, 91, 102, 429, 445
DpnII	GATC	5 cut(s)	67, 89, 100, 427, 443
DriI	GACNNNNNGTC	1 cut(s)	83
Eam1105I	GACNNNNNGTC	1 cut(s)	83
Eco130I	CCWWGG	1 cut(s)	205
Eco47I	GGWCC	1 cut(s)	278
EcoRI	GAATTC	1 cut(s)	189
EcoT14I	CCWWGG	1 cut(s)	205
ErhI	CCWWGG	1 cut(s)	205
FaeI	CATG	2 cut(s)	74, 141
FaiI	YATR	6 cut(s)	72, 139, 182, 273, 390, 392
FatI	CATG	2 cut(s)	70, 137
FspBI	CTAG	1 cut(s)	402
GlaI	GCGC	1 cut(s)	319
GsuI	CTGGAG	1 cut(s)	180
HhaI	GCGC	1 cut(s)	320
Hin1II	CATG	2 cut(s)	74, 141
Hin6I	GCGC	1 cut(s)	318
HinP1I	GCGC	1 cut(s)	318
HinfI	GANTC	2 cut(s)	344, 398
HphI	GGTGA	2 cut(s)	245, 392
Hpy188I	TCNGA	3 cut(s)	89, 327, 438
Hpy188III	TCNNGA	1 cut(s)	23
HpyAV	CCTTC	3 cut(s)	4, 64, 144
HpyCH4III	ACNGT	1 cut(s)	216
HpyF3I	CTNAG	6 cut(s)	63, 222, 324, 362, 411, 437
Hsp92II	CATG	2 cut(s)	74, 141
HspAI	GCGC	1 cut(s)	318
Kzo9I	GATC	5 cut(s)	67, 89, 100, 427, 443
LpnPI	CCDG	6 cut(s)	20, 144, 261, 351, 398, 438
MaeI	CTAG	1 cut(s)	402
MaeIII	GTNAC	1 cut(s)	149
MalI	GATC	5 cut(s)	69, 91, 102, 429, 445
MboI	GATC	5 cut(s)	67, 89, 100, 427, 443
MboII	GAAGA	3 cut(s)	178, 311, 453
MflI	RGATCY	2 cut(s)	89, 443
MluCI	AATT	7 cut(s)	29, 108, 189, 313, 375, 393, 454
MmeI	TCCRAC	1 cut(s)	55
MnlI	CCTC	3 cut(s)	58, 166, 418
NdeII	GATC	5 cut(s)	67, 89, 100, 427, 443
NlaIII	CATG	2 cut(s)	74, 141
NlaIV	GGNNCC	1 cut(s)	116
NspV	TTCGAA	1 cut(s)	187
PfeI	GAWTC	2 cut(s)	344, 398
PflMI	CCANNNNNTGG	1 cut(s)	254
PspN4I	GGNNCC	1 cut(s)	116
PspPI	GGNCC	1 cut(s)	278
PsuI	RGATCY	2 cut(s)	89, 443
RsaI	GTAC	3 cut(s)	36, 200, 259
RsaNI	GTAC	3 cut(s)	35, 199, 258
Sau3AI	GATC	5 cut(s)	67, 89, 100, 427, 443
Sau96I	GGNCC	1 cut(s)	278
ScaI	AGTACT	1 cut(s)	200
SetI	ASST	4 cut(s)	160, 340, 363, 427
SfuI	TTCGAA	1 cut(s)	187
SinI	GGWCC	1 cut(s)	278
Sse9I	AATT	7 cut(s)	29, 108, 189, 313, 375, 393, 454
SsiI	CCGC	2 cut(s)	118, 463
SspMI	CTAG	1 cut(s)	402
StyI	CCWWGG	1 cut(s)	205
TaaI	ACNGT	1 cut(s)	216
TaqI	TCGA	2 cut(s)	187, 451
TasI	AATT	7 cut(s)	29, 108, 189, 313, 375, 393, 454
TatI	WGTACW	1 cut(s)	198
TfiI	GAWTC	2 cut(s)	344, 398
TscAI	CASTG	1 cut(s)	64
TspDTI	ATGAA	2 cut(s)	126, 182
TspRI	CASTG	1 cut(s)	64
Van91I	CCANNNNNTGG	1 cut(s)	254
VpaK11BI	GGWCC	1 cut(s)	278
XapI	RAATTY	3 cut(s)	29, 189, 454
XspI	CTAG	1 cut(s)	402
ZrmI	AGTACT	1 cut(s)	200

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.