Rmu_sc0027729.1_g000001

Non-structural maintenance of chromosomes element 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027729.1
Physical Location & Seq
Reverse (-)
1 .. 837
837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027729.1_g000001.1.cds

Sequence Viewer

Length: 246 bp
atgtcccagaaggaaaaaactcttgatgaatttgtacgggataaatggctgtccttcactgctgagggtcatgttaaacttggtgtcagatccttccttgatctgcgaagttggtttcgcaataatgatgttccttcatgcgaagtgtgcaacgaaactggcgtgaaggcagtgttatgccagaaagagggttgttcggttcgaattcatcagtactgcctaggaaaactgtttgctaagaaaaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.47

Weight (kDa)

9.1

Isoelectric Point (pI)

38.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 84
AcsI RAATTY 2 cut(s) 29, 204
AfaI GTAC 2 cut(s) 36, 215
AfiI CCNNNNNNNGG 1 cut(s) 187
AlwI GGATC 1 cut(s) 84
ApoI RAATTY 2 cut(s) 29, 204
AspA2I CCTAGG 1 cut(s) 220
AsuII TTCGAA 1 cut(s) 202
AvrII CCTAGG 1 cut(s) 220
BbvCI CCTCAGC 1 cut(s) 63
BfaI CTAG 1 cut(s) 221
BlnI CCTAGG 1 cut(s) 220
BmcAI AGTACT 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 63
Bpu14I TTCGAA 1 cut(s) 202
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 187
Bsp119I TTCGAA 1 cut(s) 202
Bsp143I GATC 2 cut(s) 89, 100
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 84
BspT104I TTCGAA 1 cut(s) 202
BsrI ACTGG 1 cut(s) 163
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 2 cut(s) 89, 100
BssT1I CCWWGG 1 cut(s) 220
Bst4CI ACNGT 1 cut(s) 231
BstBI TTCGAA 1 cut(s) 202
BstDEI CTNAG 2 cut(s) 63, 237
BstKTI GATC 2 cut(s) 92, 103
BstMBI GATC 2 cut(s) 89, 100
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BtsI GCAGTG 2 cut(s) 57, 177
BtsIMutI CAGTG 2 cut(s) 57, 177
Csp6I GTAC 2 cut(s) 35, 214
CviAII CATG 2 cut(s) 71, 138
CviJI RGCY 1 cut(s) 49
CviKI_1 RGCY 1 cut(s) 49
CviQI GTAC 2 cut(s) 35, 214
DdeI CTNAG 2 cut(s) 63, 237
DpnI GATC 2 cut(s) 91, 102
DpnII GATC 2 cut(s) 89, 100
Eco130I CCWWGG 1 cut(s) 220
EcoRI GAATTC 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 2 cut(s) 74, 141
FaiI YATR 3 cut(s) 72, 139, 178
FatI CATG 2 cut(s) 70, 137
FspBI CTAG 1 cut(s) 221
Hin1II CATG 2 cut(s) 74, 141
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 5 cut(s) 4, 64, 103, 144, 160
HpyCH4III ACNGT 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
HpyF3I CTNAG 2 cut(s) 63, 237
Hsp92II CATG 2 cut(s) 74, 141
Kzo9I GATC 2 cut(s) 89, 100
LpnPI CCDG 3 cut(s) 20, 144, 194
MaeI CTAG 1 cut(s) 221
MalI GATC 2 cut(s) 91, 102
MboI GATC 2 cut(s) 89, 100
MflI RGATCY 1 cut(s) 89
MluCI AATT 2 cut(s) 29, 204
MnlI CCTC 2 cut(s) 58, 181
MseI TTAA 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 147
NdeII GATC 2 cut(s) 89, 100
NlaIII CATG 2 cut(s) 74, 141
NspV TTCGAA 1 cut(s) 202
PcsI WCGNNNNNNNCGW 1 cut(s) 159
PsuI RGATCY 1 cut(s) 89
RsaI GTAC 2 cut(s) 36, 215
RsaNI GTAC 2 cut(s) 35, 214
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 2 cut(s) 89, 100
ScaI AGTACT 1 cut(s) 215
SfuI TTCGAA 1 cut(s) 202
Sse9I AATT 2 cut(s) 29, 204
SspMI CTAG 1 cut(s) 221
StyI CCWWGG 1 cut(s) 220
TaaI ACNGT 1 cut(s) 231
TaqI TCGA 1 cut(s) 202
TasI AATT 2 cut(s) 29, 204
TatI WGTACW 1 cut(s) 213
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 2 cut(s) 64, 177
TspDTI ATGAA 3 cut(s) 42, 126, 197
TspRI CASTG 2 cut(s) 64, 177
XapI RAATTY 2 cut(s) 29, 204
XmaJI CCTAGG 1 cut(s) 220
XspI CTAG 1 cut(s) 221
ZrmI AGTACT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.