RchiOBHm_Chr6g0256561

Non-structural maintenance of chromosomes element 1 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0003611
Physical Location & Seq
Forward (+)
11770860 .. 11775297
4438 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23016

Sequence Viewer

Length: 408 bp
ATGATTAGAGAATCAGGTGTTAACAGTGGTACATCATCACAATCACAAGGAGATTCACTTCCTATCCCTACTGCATTGAAGAACTTTTCAATGTCCCAAAAGGAAAAAACTCTTGATGAATTTGTACGGGATAAATGGCTTTCCTTCACTGCTGAGGGTCATGTTGGACTTGGTGTCAGATCCTTCCTTGATCTGCGAAATTGGTTTCGCAATAATGATGTTCCTTCATGCGAAGTGTGCAACGAAACTGGCGTGAAGGCAGTGTTATGCCAGAAAGAGGGTTGTTCGGTTCGAATTCATCAGTACTGCCTAGGAAAACCGTTTGCTAAGAAAAAGGGTGAGAGTTTGTCCAAGTTGTGGTACTCAATGGCAATAAACAGGACCAAAAGCAGAACCTGTAGAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SMC_Nse1 zf-RING-like

Protein Analysis

135

Amino Acids

15.23

Weight (kDa)

9.51

Isoelectric Point (pI)

43.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SMC_Nse1 PF07574 14 - 65 2.5e-10 Nse1 non-SMC component of SMC5-6 complex
zf-RING-like PF08746 77 - 112 1.1e-08 RING-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 357
AclWI GGATC 1 cut(s) 174
AcsI RAATTY 2 cut(s) 119, 294
AfaI GTAC 4 cut(s) 31, 126, 305, 362
AfiI CCNNNNNNNGG 2 cut(s) 277, 357
AgsI TTSAA 2 cut(s) 79, 90
AhdI GACNNNNNGTC 1 cut(s) 173
AlwI GGATC 1 cut(s) 174
AlwNI CAGNNNCTG 1 cut(s) 396
ApoI RAATTY 2 cut(s) 119, 294
AspA2I CCTAGG 1 cut(s) 310
AspS9I GGNCC 1 cut(s) 381
AsuHPI GGTGA 1 cut(s) 350
AsuII TTCGAA 1 cut(s) 292
AvaII GGWCC 1 cut(s) 381
AvrII CCTAGG 1 cut(s) 310
BbvCI CCTCAGC 1 cut(s) 153
BfaI CTAG 1 cut(s) 311
BfmI CTRYAG 1 cut(s) 397
BlnI CCTAGG 1 cut(s) 310
BmcAI AGTACT 1 cut(s) 305
Bme18I GGWCC 1 cut(s) 381
BmeRI GACNNNNNGTC 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 381
Bpu10I CCTNAGC 1 cut(s) 153
Bpu14I TTCGAA 1 cut(s) 292
BsaJI CCNNGG 1 cut(s) 310
Bsc4I CCNNNNNNNGG 2 cut(s) 277, 357
Bse1I ACTGG 1 cut(s) 253
BseDI CCNNGG 1 cut(s) 310
BseLI CCNNNNNNNGG 2 cut(s) 277, 357
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 253
BslFI GGGAC 1 cut(s) 79
BslI CCNNNNNNNGG 2 cut(s) 277, 357
BsmFI GGGAC 1 cut(s) 79
Bsp119I TTCGAA 1 cut(s) 292
Bsp143I GATC 2 cut(s) 179, 190
BspCNI CTCAG 1 cut(s) 145
BspPI GGATC 1 cut(s) 174
BspT104I TTCGAA 1 cut(s) 292
BsrI ACTGG 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 2 cut(s) 179, 190
BssT1I CCWWGG 1 cut(s) 310
Bst4CI ACNGT 2 cut(s) 26, 321
BstBI TTCGAA 1 cut(s) 292
BstDEI CTNAG 2 cut(s) 153, 327
BstKTI GATC 2 cut(s) 182, 193
BstMBI GATC 2 cut(s) 179, 190
BstMWI GCNNNNNNNGC 1 cut(s) 237
BstSFI CTRYAG 1 cut(s) 397
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BtsI GCAGTG 2 cut(s) 147, 267
BtsIMutI CAGTG 3 cut(s) 31, 147, 267
CaiI CAGNNNCTG 1 cut(s) 396
Cfr13I GGNCC 1 cut(s) 381
Csp6I GTAC 4 cut(s) 30, 125, 304, 361
CviAII CATG 2 cut(s) 161, 228
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
CviQI GTAC 4 cut(s) 30, 125, 304, 361
DdeI CTNAG 2 cut(s) 153, 327
DpnI GATC 2 cut(s) 181, 192
DpnII GATC 2 cut(s) 179, 190
DriI GACNNNNNGTC 1 cut(s) 173
Eam1105I GACNNNNNGTC 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 310
Eco47I GGWCC 1 cut(s) 381
EcoRI GAATTC 1 cut(s) 294
EcoT14I CCWWGG 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 310
FaeI CATG 2 cut(s) 164, 231
FaiI YATR 3 cut(s) 162, 229, 268
FaqI GGGAC 1 cut(s) 79
FatI CATG 2 cut(s) 160, 227
FspBI CTAG 1 cut(s) 311
Hin1II CATG 2 cut(s) 164, 231
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 2 cut(s) 11, 53
HpaI GTTAAC 1 cut(s) 22
HphI GGTGA 1 cut(s) 350
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 4 cut(s) 154, 193, 234, 250
HpyCH4III ACNGT 2 cut(s) 26, 321
HpyCH4V TGCA 2 cut(s) 74, 240
HpyF10VI GCNNNNNNNGC 1 cut(s) 237
HpyF3I CTNAG 2 cut(s) 153, 327
Hsp92II CATG 2 cut(s) 164, 231
KspAI GTTAAC 1 cut(s) 22
Kzo9I GATC 2 cut(s) 179, 190
LpnPI CCDG 3 cut(s) 234, 284, 364
MaeI CTAG 1 cut(s) 311
MalI GATC 2 cut(s) 181, 192
MboI GATC 2 cut(s) 179, 190
MboII GAAGA 1 cut(s) 91
MflI RGATCY 1 cut(s) 179
MluCI AATT 3 cut(s) 119, 199, 294
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 2 cut(s) 148, 271
MseI TTAA 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 237
NdeII GATC 2 cut(s) 179, 190
NlaIII CATG 2 cut(s) 164, 231
NspV TTCGAA 1 cut(s) 292
PcsI WCGNNNNNNNCGW 1 cut(s) 249
PfeI GAWTC 2 cut(s) 11, 53
PflMI CCANNNNNTGG 1 cut(s) 357
PspPI GGNCC 1 cut(s) 381
PstNI CAGNNNCTG 1 cut(s) 396
PsuI RGATCY 1 cut(s) 179
RsaI GTAC 4 cut(s) 31, 126, 305, 362
RsaNI GTAC 4 cut(s) 30, 125, 304, 361
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 2 cut(s) 179, 190
Sau96I GGNCC 1 cut(s) 381
ScaI AGTACT 1 cut(s) 305
SetI ASST 2 cut(s) 19, 398
SfcI CTRYAG 1 cut(s) 397
SfuI TTCGAA 1 cut(s) 292
SinI GGWCC 1 cut(s) 381
Sse9I AATT 3 cut(s) 119, 199, 294
SspMI CTAG 1 cut(s) 311
StyI CCWWGG 1 cut(s) 310
TaaI ACNGT 2 cut(s) 26, 321
TaqI TCGA 1 cut(s) 292
TasI AATT 3 cut(s) 119, 199, 294
TatI WGTACW 1 cut(s) 303
TfiI GAWTC 2 cut(s) 11, 53
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TscAI CASTG 3 cut(s) 31, 154, 267
TspDTI ATGAA 3 cut(s) 132, 216, 287
TspRI CASTG 3 cut(s) 31, 154, 267
Van91I CCANNNNNTGG 1 cut(s) 357
VpaK11BI GGWCC 1 cut(s) 381
XapI RAATTY 2 cut(s) 119, 294
XmaJI CCTAGG 1 cut(s) 310
XspI CTAG 1 cut(s) 311
ZrmI AGTACT 1 cut(s) 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.