Rmu_sc0004368.1_g000013

Non-structural maintenance of chromosomes element 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004368.1
Physical Location & Seq
Forward (+)
62528 .. 63300
773 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004368.1_g000013.1.cds

Sequence Viewer

Length: 372 bp
atgtcccaaaaggaaaaaactcttgatgaatttgtacgggataaatggctttccttcactgctgagggtcatgttggacttggtgtcagatccttccttgatctgcgaagttggtttcgcaataatgatgttccttcatgcgaagtgtgcaacgaaactggcgtgaaggcagtgttatgccagaaagagggttgttcggttcgaattcatcagtactgcctaggaaaactggtgagagtttgtccaagttgtggtactcaatggcaatatacaggaccaaaagcagaacctgtagaagatgatgagccagattgcactactcagagccaaccacctgtggaacccaagagaaagaagttgagaacaagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.95

Weight (kDa)

7.52

Isoelectric Point (pI)

54.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 251
AclWI GGATC 1 cut(s) 84
AcsI RAATTY 2 cut(s) 29, 204
AfaI GTAC 3 cut(s) 36, 215, 256
AfiI CCNNNNNNNGG 2 cut(s) 187, 251
AhdI GACNNNNNGTC 1 cut(s) 83
AluBI AGCT 1 cut(s) 369
AluI AGCT 1 cut(s) 369
AlwI GGATC 1 cut(s) 84
AlwNI CAGNNNCTG 1 cut(s) 290
ApoI RAATTY 2 cut(s) 29, 204
AspA2I CCTAGG 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 275
AsuHPI GGTGA 1 cut(s) 244
AsuII TTCGAA 1 cut(s) 202
AvaII GGWCC 1 cut(s) 275
AvrII CCTAGG 1 cut(s) 220
BbvCI CCTCAGC 1 cut(s) 63
BfaI CTAG 1 cut(s) 221
BfmI CTRYAG 1 cut(s) 291
BlnI CCTAGG 1 cut(s) 220
BmcAI AGTACT 1 cut(s) 215
Bme18I GGWCC 1 cut(s) 275
BmeRI GACNNNNNGTC 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 275
BmiI GGNNCC 1 cut(s) 342
Bpu10I CCTNAGC 1 cut(s) 63
Bpu14I TTCGAA 1 cut(s) 202
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 187, 251
Bse1I ACTGG 2 cut(s) 163, 234
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 2 cut(s) 187, 251
BseMII CTCAG 2 cut(s) 54, 335
BseNI ACTGG 2 cut(s) 163, 234
BslI CCNNNNNNNGG 2 cut(s) 187, 251
Bsp119I TTCGAA 1 cut(s) 202
Bsp143I GATC 2 cut(s) 89, 100
BspCNI CTCAG 2 cut(s) 55, 334
BspLI GGNNCC 1 cut(s) 342
BspPI GGATC 1 cut(s) 84
BspT104I TTCGAA 1 cut(s) 202
BsrI ACTGG 2 cut(s) 163, 234
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 2 cut(s) 89, 100
BssT1I CCWWGG 1 cut(s) 220
BstBI TTCGAA 1 cut(s) 202
BstDEI CTNAG 2 cut(s) 63, 321
BstKTI GATC 2 cut(s) 92, 103
BstMBI GATC 2 cut(s) 89, 100
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstSFI CTRYAG 1 cut(s) 291
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BtsI GCAGTG 2 cut(s) 57, 177
BtsIMutI CAGTG 2 cut(s) 57, 177
CaiI CAGNNNCTG 1 cut(s) 290
Cfr13I GGNCC 1 cut(s) 275
Csp6I GTAC 3 cut(s) 35, 214, 255
CviAII CATG 2 cut(s) 71, 138
CviJI RGCY 4 cut(s) 49, 307, 327, 369
CviKI_1 RGCY 4 cut(s) 49, 307, 327, 369
CviQI GTAC 3 cut(s) 35, 214, 255
DdeI CTNAG 2 cut(s) 63, 321
DpnI GATC 2 cut(s) 91, 102
DpnII GATC 2 cut(s) 89, 100
DriI GACNNNNNGTC 1 cut(s) 83
Eam1105I GACNNNNNGTC 1 cut(s) 83
Eco130I CCWWGG 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 275
EcoRI GAATTC 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 2 cut(s) 74, 141
FaiI YATR 4 cut(s) 72, 139, 178, 270
FatI CATG 2 cut(s) 70, 137
FspBI CTAG 1 cut(s) 221
Hin1II CATG 2 cut(s) 74, 141
HphI GGTGA 1 cut(s) 244
Hpy188I TCNGA 2 cut(s) 89, 324
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 4 cut(s) 64, 103, 144, 160
HpyCH4V TGCA 2 cut(s) 150, 315
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
HpyF3I CTNAG 2 cut(s) 63, 321
Hsp92II CATG 2 cut(s) 74, 141
Kzo9I GATC 2 cut(s) 89, 100
LpnPI CCDG 7 cut(s) 144, 194, 215, 258, 303, 321, 348
MaeI CTAG 1 cut(s) 221
MalI GATC 2 cut(s) 91, 102
MboI GATC 2 cut(s) 89, 100
MboII GAAGA 1 cut(s) 308
MflI RGATCY 1 cut(s) 89
MluCI AATT 2 cut(s) 29, 204
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 2 cut(s) 58, 181
MwoI GCNNNNNNNGC 1 cut(s) 147
NdeII GATC 2 cut(s) 89, 100
NlaIII CATG 2 cut(s) 74, 141
NlaIV GGNNCC 1 cut(s) 342
NspV TTCGAA 1 cut(s) 202
PcsI WCGNNNNNNNCGW 1 cut(s) 159
PflMI CCANNNNNTGG 1 cut(s) 251
PspN4I GGNNCC 1 cut(s) 342
PspPI GGNCC 1 cut(s) 275
PstNI CAGNNNCTG 1 cut(s) 290
PsuI RGATCY 1 cut(s) 89
RsaI GTAC 3 cut(s) 36, 215, 256
RsaNI GTAC 3 cut(s) 35, 214, 255
Sau3AI GATC 2 cut(s) 89, 100
Sau96I GGNCC 1 cut(s) 275
ScaI AGTACT 1 cut(s) 215
SetI ASST 3 cut(s) 292, 337, 371
SfcI CTRYAG 1 cut(s) 291
SfuI TTCGAA 1 cut(s) 202
SinI GGWCC 1 cut(s) 275
Sse9I AATT 2 cut(s) 29, 204
SspMI CTAG 1 cut(s) 221
StyI CCWWGG 1 cut(s) 220
TaqI TCGA 1 cut(s) 202
TasI AATT 2 cut(s) 29, 204
TatI WGTACW 1 cut(s) 213
TscAI CASTG 2 cut(s) 64, 177
TspDTI ATGAA 3 cut(s) 42, 126, 197
TspRI CASTG 2 cut(s) 64, 177
Van91I CCANNNNNTGG 1 cut(s) 251
VpaK11BI GGWCC 1 cut(s) 275
XapI RAATTY 2 cut(s) 29, 204
XmaJI CCTAGG 1 cut(s) 220
XspI CTAG 1 cut(s) 221
ZrmI AGTACT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.