Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004368.1

Orthogroup ID

OG0003611

Physical Location & Seq

Genomic Coordinates Forward (+)

62528 .. 63300

Gene Structure 773 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004368.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

atgtcccaaaaggaaaaaactcttgatgaatttgtacgggataaatggctttccttcactgctgagggtcatgttggacttggtgtcagatccttccttgatctgcgaagttggtttcgcaataatgatgttccttcatgcgaagtgtgcaacgaaactggcgtgaaggcagtgttatgccagaaagagggttgttcggttcgaattcatcagtactgcctaggaaaactggtgagagtttgtccaagttgtggtactcaatggcaatatacaggaccaaaagcagaacctgtagaagatgatgagccagattgcactactcagagccaaccacctgtggaacccaagagaaagaagttgagaacaagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SMC_Nse1 zf-RING-like

Protein Analysis

123

Amino Acids

13.95

Weight (kDa)

7.52

Isoelectric Point (pI)

54.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003611)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G21140
fragaria_vesca	FvH4_3g30540 FvH4_3g30540 FvH4_3g30540 FvH4_3g30540
malus_domestica	MD11G1180700.v1.1
prunus_persica	Prupe.6G153500_v2.0.a1
pyrus_communis	pycom11g15590
rosa_chinensis	RchiOBHm_Chr5g0056151 RchiOBHm_Chr5g0056531 RchiOBHm_Chr6g0256561
rosa_laevigata	RLG00000035103
rosa_multiflora	Rmu_sc0000366.1_g000003 Rmu_sc0000366.1_g000039 Rmu_sc0001787.1_g000001 Rmu_sc0002204.1_g000004 Rmu_sc0004101.1_g000056 Rmu_sc0004174.1_g000007 Rmu_sc0004368.1_g000013 Rmu_sc0027729.1_g000001
rosa_roxburghii	Rroxscaffold_1G00023800
rosa_rugosa	Rorug05G0300600
rosa_samantha	Rh1BG210900 Rh1DG237500 Rh5AG370900 Rh5AG477300 Rh5BG382100 Rh5BG497800 Rh5CG324300 Rh5CG405300 Rh5DG395000
rosa_wichuraiana	Rw0G022130 Rw1G009200 Rw2G024960 Rw5G034750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	251
AclWI	GGATC	1 cut(s)	84
AcsI	RAATTY	2 cut(s)	29, 204
AfaI	GTAC	3 cut(s)	36, 215, 256
AfiI	CCNNNNNNNGG	2 cut(s)	187, 251
AhdI	GACNNNNNGTC	1 cut(s)	83
AluBI	AGCT	1 cut(s)	369
AluI	AGCT	1 cut(s)	369
AlwI	GGATC	1 cut(s)	84
AlwNI	CAGNNNCTG	1 cut(s)	290
ApoI	RAATTY	2 cut(s)	29, 204
AspA2I	CCTAGG	1 cut(s)	220
AspS9I	GGNCC	1 cut(s)	275
AsuHPI	GGTGA	1 cut(s)	244
AsuII	TTCGAA	1 cut(s)	202
AvaII	GGWCC	1 cut(s)	275
AvrII	CCTAGG	1 cut(s)	220
BbvCI	CCTCAGC	1 cut(s)	63
BfaI	CTAG	1 cut(s)	221
BfmI	CTRYAG	1 cut(s)	291
BlnI	CCTAGG	1 cut(s)	220
BmcAI	AGTACT	1 cut(s)	215
Bme18I	GGWCC	1 cut(s)	275
BmeRI	GACNNNNNGTC	1 cut(s)	83
BmgT120I	GGNCC	1 cut(s)	275
BmiI	GGNNCC	1 cut(s)	342
Bpu10I	CCTNAGC	1 cut(s)	63
Bpu14I	TTCGAA	1 cut(s)	202
BsaJI	CCNNGG	1 cut(s)	220
Bsc4I	CCNNNNNNNGG	2 cut(s)	187, 251
Bse1I	ACTGG	2 cut(s)	163, 234
BseDI	CCNNGG	1 cut(s)	220
BseLI	CCNNNNNNNGG	2 cut(s)	187, 251
BseMII	CTCAG	2 cut(s)	54, 335
BseNI	ACTGG	2 cut(s)	163, 234
BslI	CCNNNNNNNGG	2 cut(s)	187, 251
Bsp119I	TTCGAA	1 cut(s)	202
Bsp143I	GATC	2 cut(s)	89, 100
BspCNI	CTCAG	2 cut(s)	55, 334
BspLI	GGNNCC	1 cut(s)	342
BspPI	GGATC	1 cut(s)	84
BspT104I	TTCGAA	1 cut(s)	202
BsrI	ACTGG	2 cut(s)	163, 234
BssECI	CCNNGG	1 cut(s)	220
BssMI	GATC	2 cut(s)	89, 100
BssT1I	CCWWGG	1 cut(s)	220
BstBI	TTCGAA	1 cut(s)	202
BstDEI	CTNAG	2 cut(s)	63, 321
BstKTI	GATC	2 cut(s)	92, 103
BstMBI	GATC	2 cut(s)	89, 100
BstMWI	GCNNNNNNNGC	1 cut(s)	147
BstSFI	CTRYAG	1 cut(s)	291
BstX2I	RGATCY	1 cut(s)	89
BstYI	RGATCY	1 cut(s)	89
BtsI	GCAGTG	2 cut(s)	57, 177
BtsIMutI	CAGTG	2 cut(s)	57, 177
CaiI	CAGNNNCTG	1 cut(s)	290
Cfr13I	GGNCC	1 cut(s)	275
Csp6I	GTAC	3 cut(s)	35, 214, 255
CviAII	CATG	2 cut(s)	71, 138
CviJI	RGCY	4 cut(s)	49, 307, 327, 369
CviKI_1	RGCY	4 cut(s)	49, 307, 327, 369
CviQI	GTAC	3 cut(s)	35, 214, 255
DdeI	CTNAG	2 cut(s)	63, 321
DpnI	GATC	2 cut(s)	91, 102
DpnII	GATC	2 cut(s)	89, 100
DriI	GACNNNNNGTC	1 cut(s)	83
Eam1105I	GACNNNNNGTC	1 cut(s)	83
Eco130I	CCWWGG	1 cut(s)	220
Eco47I	GGWCC	1 cut(s)	275
EcoRI	GAATTC	1 cut(s)	204
EcoT14I	CCWWGG	1 cut(s)	220
ErhI	CCWWGG	1 cut(s)	220
FaeI	CATG	2 cut(s)	74, 141
FaiI	YATR	4 cut(s)	72, 139, 178, 270
FatI	CATG	2 cut(s)	70, 137
FspBI	CTAG	1 cut(s)	221
Hin1II	CATG	2 cut(s)	74, 141
HphI	GGTGA	1 cut(s)	244
Hpy188I	TCNGA	2 cut(s)	89, 324
Hpy188III	TCNNGA	1 cut(s)	23
HpyAV	CCTTC	4 cut(s)	64, 103, 144, 160
HpyCH4V	TGCA	2 cut(s)	150, 315
HpyF10VI	GCNNNNNNNGC	1 cut(s)	147
HpyF3I	CTNAG	2 cut(s)	63, 321
Hsp92II	CATG	2 cut(s)	74, 141
Kzo9I	GATC	2 cut(s)	89, 100
LpnPI	CCDG	7 cut(s)	144, 194, 215, 258, 303, 321, 348
MaeI	CTAG	1 cut(s)	221
MalI	GATC	2 cut(s)	91, 102
MboI	GATC	2 cut(s)	89, 100
MboII	GAAGA	1 cut(s)	308
MflI	RGATCY	1 cut(s)	89
MluCI	AATT	2 cut(s)	29, 204
MmeI	TCCRAC	1 cut(s)	55
MnlI	CCTC	2 cut(s)	58, 181
MwoI	GCNNNNNNNGC	1 cut(s)	147
NdeII	GATC	2 cut(s)	89, 100
NlaIII	CATG	2 cut(s)	74, 141
NlaIV	GGNNCC	1 cut(s)	342
NspV	TTCGAA	1 cut(s)	202
PcsI	WCGNNNNNNNCGW	1 cut(s)	159
PflMI	CCANNNNNTGG	1 cut(s)	251
PspN4I	GGNNCC	1 cut(s)	342
PspPI	GGNCC	1 cut(s)	275
PstNI	CAGNNNCTG	1 cut(s)	290
PsuI	RGATCY	1 cut(s)	89
RsaI	GTAC	3 cut(s)	36, 215, 256
RsaNI	GTAC	3 cut(s)	35, 214, 255
Sau3AI	GATC	2 cut(s)	89, 100
Sau96I	GGNCC	1 cut(s)	275
ScaI	AGTACT	1 cut(s)	215
SetI	ASST	3 cut(s)	292, 337, 371
SfcI	CTRYAG	1 cut(s)	291
SfuI	TTCGAA	1 cut(s)	202
SinI	GGWCC	1 cut(s)	275
Sse9I	AATT	2 cut(s)	29, 204
SspMI	CTAG	1 cut(s)	221
StyI	CCWWGG	1 cut(s)	220
TaqI	TCGA	1 cut(s)	202
TasI	AATT	2 cut(s)	29, 204
TatI	WGTACW	1 cut(s)	213
TscAI	CASTG	2 cut(s)	64, 177
TspDTI	ATGAA	3 cut(s)	42, 126, 197
TspRI	CASTG	2 cut(s)	64, 177
Van91I	CCANNNNNTGG	1 cut(s)	251
VpaK11BI	GGWCC	1 cut(s)	275
XapI	RAATTY	2 cut(s)	29, 204
XmaJI	CCTAGG	1 cut(s)	220
XspI	CTAG	1 cut(s)	221
ZrmI	AGTACT	1 cut(s)	215

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.