RchiOBHm_Chr5g0080971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
86974202 .. 86974729
528 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35524

Sequence Viewer

Length: 156 bp
ATGCCAGAGGATGAAGGCCGATTTGTAAATGATTGTCAAAGGATTCCACCGTTTTCCATAAGAGAGCTGAAGATCGATGCTGAAGAGACTGACTCCTACTACGATGCTGAAGAGATTGACTCCTACTACGATGCTGAAGATCGACTAACTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.05

Weight (kDa)

4.05

Isoelectric Point (pI)

68.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 4 cut(s) 89, 102, 129, 156
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 16
ArsI GACNNNNNNTTYG 1 cut(s) 135
BcoDI GTCTC 1 cut(s) 80
BmsI GCATC 3 cut(s) 67, 94, 121
BplI GAGNNNNNCTC 4 cut(s) 77, 109, 104, 136
Bsa29I ATCGAT 1 cut(s) 75
BseCI ATCGAT 1 cut(s) 75
BseGI GGATG 1 cut(s) 16
BshFI GGCC 1 cut(s) 18
BshVI ATCGAT 1 cut(s) 75
BsmAI GTCTC 1 cut(s) 80
BsnI GGCC 1 cut(s) 18
Bsp143I GATC 2 cut(s) 72, 139
BspANI GGCC 1 cut(s) 18
BspDI ATCGAT 1 cut(s) 75
BssMI GATC 2 cut(s) 72, 139
Bst4CI ACNGT 2 cut(s) 51, 151
Bst6I CTCTTC 2 cut(s) 78, 105
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 2 cut(s) 75, 142
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 2 cut(s) 72, 139
Bsu15I ATCGAT 1 cut(s) 75
BsuRI GGCC 1 cut(s) 18
BsuTUI ATCGAT 1 cut(s) 75
BtsCI GGATG 1 cut(s) 16
ClaI ATCGAT 1 cut(s) 75
CviJI RGCY 2 cut(s) 18, 67
CviKI_1 RGCY 2 cut(s) 18, 67
DpnI GATC 2 cut(s) 74, 141
DpnII GATC 2 cut(s) 72, 139
Eam1104I CTCTTC 2 cut(s) 78, 105
EarI CTCTTC 2 cut(s) 78, 105
Eco57I CTGAAG 4 cut(s) 89, 102, 129, 156
FaiI YATR 1 cut(s) 59
FokI GGATG 1 cut(s) 23
FspEI CC 8 cut(s) 18, 25, 32, 60, 63, 70, 109, 136
HaeIII GGCC 1 cut(s) 18
HinfI GANTC 3 cut(s) 43, 92, 119
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 2 cut(s) 51, 151
Kzo9I GATC 2 cut(s) 72, 139
LpnPI CCDG 1 cut(s) 18
LweI GCATC 3 cut(s) 67, 94, 121
MalI GATC 2 cut(s) 74, 141
MboI GATC 2 cut(s) 72, 139
MboII GAAGA 4 cut(s) 82, 95, 122, 149
MlyI GAGTC 2 cut(s) 86, 113
NdeII GATC 2 cut(s) 72, 139
PfeI GAWTC 1 cut(s) 43
PleI GAGTC 2 cut(s) 86, 113
PpsI GAGTC 2 cut(s) 86, 113
Sau3AI GATC 2 cut(s) 72, 139
SchI GAGTC 2 cut(s) 86, 113
SetI ASST 1 cut(s) 69
SfaNI GCATC 3 cut(s) 67, 94, 121
SgeI CNNG 1 cut(s) 17
TaaI ACNGT 2 cut(s) 51, 151
TaqI TCGA 2 cut(s) 75, 142
TfiI GAWTC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.