RchiOBHm_Chr6g0266431

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
22788580 .. 22790100
1521 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23894

Sequence Viewer

Length: 225 bp
ATGAGAAGGCAGATATCATTTATGAAATCTGTCATCAGCCTTATCAACCTGGTTATACTGCCCCATCACCTCCCCCTTAGTTTGACGACACTACTATTGACATCAGGCAAGTTCACAATTTACATAGGCCTTTTAACTCAGTTAATATTGCTACTATGGGATTTTTTTTTCCTTTTGGTTTTTCAGAATAAAAATTTGGAAAGACGCCAGGATTTATATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.78

Weight (kDa)

10.16

Isoelectric Point (pI)

45.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 193
AcyI GRCGYC 1 cut(s) 205
AjnI CCWGG 2 cut(s) 48, 207
AjuI GAANNNNNNNTTGG 2 cut(s) 179, 211
AoxI GGCC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 59
BccI CCATC 1 cut(s) 72
BciT130I CCWGG 2 cut(s) 50, 209
Bme1390I CCNGG 2 cut(s) 50, 209
BmrFI CCNGG 2 cut(s) 50, 209
BsaHI GRCGYC 1 cut(s) 205
BseBI CCWGG 2 cut(s) 50, 209
BseMII CTCAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 129
BsnI GGCC 1 cut(s) 129
BspANI GGCC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 151
BssNI GRCGYC 1 cut(s) 205
Bst2UI CCWGG 2 cut(s) 50, 209
BstACI GRCGYC 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 77, 138
BstNI CCWGG 2 cut(s) 50, 209
BstSCI CCNGG 2 cut(s) 48, 207
BsuRI GGCC 1 cut(s) 129
CseI GACGC 1 cut(s) 213
CsiI ACCWGGT 1 cut(s) 48
CviJI RGCY 2 cut(s) 39, 129
CviKI_1 RGCY 2 cut(s) 39, 129
DdeI CTNAG 2 cut(s) 77, 138
Eco147I AGGCCT 1 cut(s) 129
Eco32I GATATC 1 cut(s) 15
EcoRII CCWGG 2 cut(s) 48, 207
EcoRV GATATC 1 cut(s) 15
FaiI YATR 8 cut(s) 23, 56, 125, 157, 217, 219, 221, 223
HaeIII GGCC 1 cut(s) 129
HgaI GACGC 1 cut(s) 213
Hin1I GRCGYC 1 cut(s) 205
HphI GGTGA 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 114
Hpy188I TCNGA 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 114
HpyF3I CTNAG 2 cut(s) 77, 138
Hsp92I GRCGYC 1 cut(s) 205
LpnPI CCDG 5 cut(s) 35, 62, 90, 194, 221
MabI ACCWGGT 1 cut(s) 48
MluCI AATT 2 cut(s) 117, 193
MnlI CCTC 1 cut(s) 80
MseI TTAA 2 cut(s) 134, 143
MspR9I CCNGG 2 cut(s) 50, 209
MvaI CCWGG 2 cut(s) 50, 209
PceI AGGCCT 1 cut(s) 129
Psp6I CCWGG 2 cut(s) 48, 207
PspGI CCWGG 2 cut(s) 48, 207
SaqAI TTAA 2 cut(s) 134, 143
ScrFI CCNGG 2 cut(s) 50, 209
SetI ASST 2 cut(s) 51, 72
SexAI ACCWGGT 1 cut(s) 48
SgeI CNNG 6 cut(s) 61, 62, 117, 121, 220, 221
Sse9I AATT 2 cut(s) 117, 193
SseBI AGGCCT 1 cut(s) 129
SspI AATATT 1 cut(s) 147
StuI AGGCCT 1 cut(s) 129
StyD4I CCNGG 2 cut(s) 48, 207
TasI AATT 2 cut(s) 117, 193
Tru1I TTAA 2 cut(s) 134, 143
Tru9I TTAA 2 cut(s) 134, 143
TspDTI ATGAA 1 cut(s) 38
XapI RAATTY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.