Rh5AG159800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0008177
Physical Location & Seq
Reverse (-)
16988764 .. 16989132
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG159800.1

Sequence Viewer

Length: 258 bp
ATGGTTGTGTTCTTCTCGTGGTGGCGCCCTGATCGTGATGGAGGTCAGGCATTAGCCTTTGGTGCTACTAATGTTGATGGGTTTGGAAACCAGATTAAGATGGTGTTAAGTAGTGCTGACGTCGGCGGAGCTACTATCATGGTTTGGTGGGCTGTGGCTATCGGACGACAGGTCTCTGATGTTAGTGATGTAGATCTAGGCCAGCTTGTTGGAAGGCATGGTGATGGTCTTGTCATTGGTGATGGCGCCCATTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.02

Weight (kDa)

4.59

Isoelectric Point (pI)

10.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 123
AccB1I GGYRCC 2 cut(s) 24, 245
AciI CCGC 1 cut(s) 126
AcyI GRCGYC 3 cut(s) 25, 120, 246
AhdI GACNNNNNGTC 1 cut(s) 170
AluBI AGCT 2 cut(s) 131, 205
AluI AGCT 2 cut(s) 131, 205
Alw26I GTCTC 1 cut(s) 178
AoxI GGCC 1 cut(s) 199
AspLEI GCGC 2 cut(s) 27, 248
AsuHPI GGTGA 2 cut(s) 233, 251
BanI GGYRCC 2 cut(s) 24, 245
BauI CACGAG 1 cut(s) 16
BccI CCATC 5 cut(s) 32, 71, 94, 218, 236
BcoDI GTCTC 1 cut(s) 178
BfaI CTAG 1 cut(s) 197
BfoI RGCGCY 2 cut(s) 28, 249
BglII AGATCT 1 cut(s) 193
BmeRI GACNNNNNGTC 1 cut(s) 170
BmiI GGNNCC 2 cut(s) 26, 247
BsaBI GATNNNNATC 1 cut(s) 192
BsaHI GRCGYC 3 cut(s) 25, 120, 246
BsaI GGTCTC 1 cut(s) 178
Bse8I GATNNNNATC 1 cut(s) 192
BseJI GATNNNNATC 1 cut(s) 192
BshFI GGCC 1 cut(s) 201
BshNI GGYRCC 2 cut(s) 24, 245
BsmAI GTCTC 1 cut(s) 178
BsnI GGCC 1 cut(s) 201
Bso31I GGTCTC 1 cut(s) 178
Bsp143I GATC 2 cut(s) 31, 193
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 201
BspLI GGNNCC 2 cut(s) 26, 247
BspT107I GGYRCC 2 cut(s) 24, 245
BspTNI GGTCTC 1 cut(s) 178
BssMI GATC 2 cut(s) 31, 193
BssNI GRCGYC 3 cut(s) 25, 120, 246
BssSI CACGAG 1 cut(s) 16
Bst2BI CACGAG 1 cut(s) 16
BstACI GRCGYC 3 cut(s) 25, 120, 246
BstC8I GCNNGC 1 cut(s) 203
BstH2I RGCGCY 2 cut(s) 28, 249
BstHHI GCGC 2 cut(s) 27, 248
BstKTI GATC 2 cut(s) 34, 196
BstMAI GTCTC 1 cut(s) 178
BstMBI GATC 2 cut(s) 31, 193
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 193
BstXI CCANNNNNNTGG 1 cut(s) 209
BstYI RGATCY 1 cut(s) 193
BsuRI GGCC 1 cut(s) 201
Cac8I GCNNGC 1 cut(s) 203
CfoI GCGC 2 cut(s) 27, 248
CviAII CATG 2 cut(s) 139, 218
CviJI RGCY 6 cut(s) 56, 131, 152, 158, 201, 205
CviKI_1 RGCY 6 cut(s) 56, 131, 152, 158, 201, 205
DinI GGCGCC 2 cut(s) 26, 247
DpnI GATC 2 cut(s) 33, 195
DpnII GATC 2 cut(s) 31, 193
DriI GACNNNNNGTC 1 cut(s) 170
Eam1105I GACNNNNNGTC 1 cut(s) 170
EciI GGCGGA 1 cut(s) 141
Eco31I GGTCTC 1 cut(s) 178
EgeI GGCGCC 2 cut(s) 26, 247
EheI GGCGCC 2 cut(s) 26, 247
FaeI CATG 2 cut(s) 142, 221
FaiI YATR 2 cut(s) 140, 219
FatI CATG 2 cut(s) 138, 217
FspBI CTAG 1 cut(s) 197
GlaI GCGC 2 cut(s) 26, 247
HaeII RGCGCY 2 cut(s) 28, 249
HaeIII GGCC 1 cut(s) 201
HhaI GCGC 2 cut(s) 27, 248
Hin1I GRCGYC 3 cut(s) 25, 120, 246
Hin1II CATG 2 cut(s) 142, 221
Hin6I GCGC 2 cut(s) 25, 246
HinP1I GCGC 2 cut(s) 25, 246
HphI GGTGA 2 cut(s) 233, 251
Hpy188I TCNGA 2 cut(s) 164, 178
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 207
HpyCH4IV ACGT 1 cut(s) 120
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpySE526I ACGT 1 cut(s) 120
Hsp92I GRCGYC 3 cut(s) 25, 120, 246
Hsp92II CATG 2 cut(s) 142, 221
HspAI GCGC 2 cut(s) 25, 246
KasI GGCGCC 2 cut(s) 24, 245
Kzo9I GATC 2 cut(s) 31, 193
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 5 cut(s) 32, 42, 104, 155, 215
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 120
MalI GATC 2 cut(s) 33, 195
MboI GATC 2 cut(s) 31, 193
MboII GAAGA 1 cut(s) 4
MflI RGATCY 1 cut(s) 193
Mly113I GGCGCC 2 cut(s) 25, 246
MmeI TCCRAC 1 cut(s) 190
MnlI CCTC 1 cut(s) 35
MseI TTAA 2 cut(s) 96, 107
MslI CAYNNNNRTG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 62
NarI GGCGCC 2 cut(s) 25, 246
NdeII GATC 2 cut(s) 31, 193
NlaIII CATG 2 cut(s) 142, 221
NlaIV GGNNCC 2 cut(s) 26, 247
PluTI GGCGCC 2 cut(s) 28, 249
PspN4I GGNNCC 2 cut(s) 26, 247
PsuI RGATCY 1 cut(s) 193
RseI CAYNNNNRTG 1 cut(s) 222
SaqAI TTAA 2 cut(s) 96, 107
Sau3AI GATC 2 cut(s) 31, 193
SetI ASST 5 cut(s) 46, 123, 133, 174, 207
SfoI GGCGCC 2 cut(s) 26, 247
SmiMI CAYNNNNRTG 1 cut(s) 222
SsiI CCGC 1 cut(s) 126
SspDI GGCGCC 2 cut(s) 24, 245
SspMI CTAG 1 cut(s) 197
TaiI ACGT 1 cut(s) 123
Tru1I TTAA 2 cut(s) 96, 107
Tru9I TTAA 2 cut(s) 96, 107
XspI CTAG 1 cut(s) 197
ZraI GACGTC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.