RchiOBHm_Chr6g0287401

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0010626
Physical Location & Seq
Reverse (-)
50749188 .. 50756887
7700 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25781

Sequence Viewer

Length: 381 bp
ATGTGTTGTAAACATTTAATCCTATTTACGACTAACTATATCAGTCAAAGAACCATGACGCCCATTTTCCTGAATCCTCCTGGCTCCTCCCTTTATAAAGATCATAATCTAAGCCAAAACATACACACACAAAAGCCAAAAGGGCAGAGGAAACAAAAACCTCACAGGTCACAACTCCCCTACTACTTCAAAATGTCATCATCTTCAAGAATCCTTCTTTGCTTGTTCTTAGTGTTGCTCACTACTAGTCTACAGCACACAGAAGCAACCTTTGAGTCTTCACTGAGTGTTGACGAAGGACCTTGGGGTAATGTTAGCTGCGTTTGGGGGGGCTTTTTAGCTTCCCCGCTTATAAGCAACAACACCCAAAGTGTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.31

Weight (kDa)

9.39

Isoelectric Point (pI)

55.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 96, 353
AccI GTMKAC 1 cut(s) 250
AciI CCGC 1 cut(s) 347
AcyI GRCGYC 1 cut(s) 59
AdeI CACNNNGTG 1 cut(s) 287
AgsI TTSAA 2 cut(s) 190, 207
AhlI ACTAGT 1 cut(s) 245
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 318, 341
AluI AGCT 2 cut(s) 318, 341
ApeKI GCWGC 1 cut(s) 318
AspS9I GGNCC 1 cut(s) 299
AvaII GGWCC 1 cut(s) 299
BbsI GAAGAC 1 cut(s) 270
BbvI GCAGC 1 cut(s) 305
BciT130I CCWGG 1 cut(s) 81
BcuI ACTAGT 1 cut(s) 245
BfaI CTAG 1 cut(s) 246
BfmI CTRYAG 1 cut(s) 251
BglI GCCNNNNNGGC 1 cut(s) 142
BisI GCNGC 1 cut(s) 319
BlsI GCNGC 1 cut(s) 320
Bme1390I CCNGG 1 cut(s) 81
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BmiI GGNNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 81
BpiI GAAGAC 1 cut(s) 270
BsaBI GATNNNNATC 1 cut(s) 105
BsaHI GRCGYC 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 302
Bse8I GATNNNNATC 1 cut(s) 105
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 302
BseJI GATNNNNATC 1 cut(s) 105
BseMII CTCAG 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 76
BseXI GCAGC 1 cut(s) 305
Bsp143I GATC 1 cut(s) 100
BspACI CCGC 1 cut(s) 347
BspCNI CTCAG 1 cut(s) 276
BspLI GGNNCC 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 302
BssMI GATC 1 cut(s) 100
BssNI GRCGYC 1 cut(s) 59
BssT1I CCWWGG 1 cut(s) 302
Bst2UI CCWGG 1 cut(s) 81
BstACI GRCGYC 1 cut(s) 59
BstDEI CTNAG 3 cut(s) 110, 229, 284
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 251
BstV1I GCAGC 1 cut(s) 305
BstV2I GAAGAC 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 299
CseI GACGC 1 cut(s) 67
CviAII CATG 1 cut(s) 55
CviJI RGCY 6 cut(s) 84, 114, 136, 318, 333, 341
CviKI_1 RGCY 6 cut(s) 84, 114, 136, 318, 333, 341
DdeI CTNAG 3 cut(s) 110, 229, 284
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
DraIII CACNNNGTG 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 302
Eco47I GGWCC 1 cut(s) 299
EcoO109I RGGNCCY 1 cut(s) 299
EcoRII CCWGG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 302
ErhI CCWWGG 1 cut(s) 302
FaeI CATG 1 cut(s) 58
FaiI YATR 6 cut(s) 39, 56, 96, 105, 122, 353
FatI CATG 1 cut(s) 54
FauI CCCGC 1 cut(s) 354
FblI GTMKAC 1 cut(s) 250
Fnu4HI GCNGC 1 cut(s) 319
Fsp4HI GCNGC 1 cut(s) 319
FspBI CTAG 1 cut(s) 246
GluI GCNGC 1 cut(s) 319
HgaI GACGC 1 cut(s) 67
Hin1I GRCGYC 1 cut(s) 59
Hin1II CATG 1 cut(s) 58
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HinfI GANTC 3 cut(s) 73, 210, 275
Hpy166II GTNNAC 3 cut(s) 11, 251, 292
Hpy188III TCNNGA 2 cut(s) 70, 207
Hpy8I GTNNAC 3 cut(s) 11, 251, 292
HpyAV CCTTC 2 cut(s) 224, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
HpyF3I CTNAG 3 cut(s) 110, 229, 284
Hsp92I GRCGYC 1 cut(s) 59
Hsp92II CATG 1 cut(s) 58
Kzo9I GATC 1 cut(s) 100
LmnI GCTCC 1 cut(s) 89
LpnPI CCDG 4 cut(s) 66, 83, 93, 151
Lsp1109I GCAGC 1 cut(s) 305
MaeI CTAG 1 cut(s) 246
MaeIII GTNAC 1 cut(s) 168
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 2 cut(s) 195, 270
MlyI GAGTC 1 cut(s) 284
MnlI CCTC 4 cut(s) 87, 97, 141, 171
MseI TTAA 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 142
NdeII GATC 1 cut(s) 100
NlaIII CATG 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 168
PfeI GAWTC 2 cut(s) 73, 210
PkrI GCNGC 1 cut(s) 320
PleI GAGTC 1 cut(s) 283
PpsI GAGTC 1 cut(s) 283
PpuMI RGGWCCY 1 cut(s) 299
PsiI TTATAA 2 cut(s) 96, 353
Psp5II RGGWCCY 1 cut(s) 299
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 85
PspPI GGNCC 1 cut(s) 299
PspPPI RGGWCCY 1 cut(s) 299
SaqAI TTAA 1 cut(s) 17
SatI GCNGC 1 cut(s) 319
Sau3AI GATC 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 299
SchI GAGTC 1 cut(s) 284
ScrFI CCNGG 1 cut(s) 81
SetI ASST 6 cut(s) 163, 170, 272, 304, 320, 343
SfcI CTRYAG 1 cut(s) 251
SinI GGWCC 1 cut(s) 299
SpeI ACTAGT 1 cut(s) 245
SsiI CCGC 1 cut(s) 347
SspMI CTAG 1 cut(s) 246
StyD4I CCNGG 1 cut(s) 79
StyI CCWWGG 1 cut(s) 302
TfiI GAWTC 2 cut(s) 73, 210
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TscAI CASTG 1 cut(s) 288
TseFI GTSAC 1 cut(s) 168
TseI GCWGC 1 cut(s) 318
Tsp45I GTSAC 1 cut(s) 168
TspRI CASTG 1 cut(s) 288
VpaK11BI GGWCC 1 cut(s) 299
XmiI GTMKAC 1 cut(s) 250
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.