Rh6BG305800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
53563180 .. 53565078
1899 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG305800.1

Sequence Viewer

Length: 225 bp
ATGGCAATCGCGTCATCAAAGGTTAAACAAGAAACTGGTCATAACTGCGGTCATGAGCGTTTGAAAAGAGATGCTCATAGTCAAATGCCTTTATTTAATATCTCGGAAAGCTCATTTCAAATATTCATCCTGGACTGCACAAGGAAGGTAAGAAAAGATTATCCAGTGAAGCTGCAACAGCTACAAATTGGAATAGCAAGAATTGCTGTCATCAAAGAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.48

Weight (kDa)

9.62

Isoelectric Point (pI)

64.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 11
AciI CCGC 1 cut(s) 48
AgsI TTSAA 2 cut(s) 64, 119
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 3 cut(s) 111, 172, 181
AluI AGCT 3 cut(s) 111, 172, 181
ApeKI GCWGC 1 cut(s) 172
BbvI GCAGC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 131
BisI GCNGC 1 cut(s) 173
BlsI GCNGC 1 cut(s) 174
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 1 cut(s) 61
Bse1I ACTGG 2 cut(s) 40, 164
BseBI CCWGG 1 cut(s) 131
BseGI GGATG 1 cut(s) 126
BseNI ACTGG 2 cut(s) 40, 164
BseXI GCAGC 1 cut(s) 159
BsgI GTGCAG 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 11
BspACI CCGC 1 cut(s) 48
BspFNI CGCG 1 cut(s) 11
BspHI TCATGA 1 cut(s) 52
BsrI ACTGG 2 cut(s) 40, 164
Bst2UI CCWGG 1 cut(s) 131
BstAPI GCANNNNNTGC 1 cut(s) 203
BstF5I GGATG 1 cut(s) 126
BstFNI CGCG 1 cut(s) 11
BstMWI GCNNNNNNNGC 2 cut(s) 178, 203
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstUI CGCG 1 cut(s) 11
BstV1I GCAGC 1 cut(s) 159
BtsCI GGATG 1 cut(s) 126
BtsIMutI CAGTG 1 cut(s) 171
CciI TCATGA 1 cut(s) 52
CviAII CATG 1 cut(s) 53
CviJI RGCY 3 cut(s) 111, 172, 181
CviKI_1 RGCY 3 cut(s) 111, 172, 181
EcoRII CCWGG 1 cut(s) 129
FaeI CATG 1 cut(s) 56
FaiI YATR 3 cut(s) 42, 54, 78
FatI CATG 1 cut(s) 52
Fnu4HI GCNGC 1 cut(s) 173
FokI GGATG 1 cut(s) 113
Fsp4HI GCNGC 1 cut(s) 173
GluI GCNGC 1 cut(s) 173
Hin1II CATG 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 138, 175
HpyF10VI GCNNNNNNNGC 2 cut(s) 178, 203
Hsp92II CATG 1 cut(s) 56
LpnPI CCDG 4 cut(s) 21, 116, 143, 177
Lsp1109I GCAGC 1 cut(s) 159
LweI GCATC 1 cut(s) 61
MluCI AATT 2 cut(s) 186, 201
MseI TTAA 2 cut(s) 24, 96
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
MvnI CGCG 1 cut(s) 11
MwoI GCNNNNNNNGC 2 cut(s) 178, 203
NlaIII CATG 1 cut(s) 56
PagI TCATGA 1 cut(s) 52
PfoI TCCNGGA 1 cut(s) 129
PkrI GCNGC 1 cut(s) 174
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
SaqAI TTAA 2 cut(s) 24, 96
SatI GCNGC 1 cut(s) 173
ScrFI CCNGG 1 cut(s) 131
SetI ASST 5 cut(s) 24, 113, 150, 174, 183
SfaNI GCATC 1 cut(s) 61
Sse9I AATT 2 cut(s) 186, 201
SsiI CCGC 1 cut(s) 48
SspI AATATT 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 129
TasI AATT 2 cut(s) 186, 201
Tru1I TTAA 2 cut(s) 24, 96
Tru9I TTAA 2 cut(s) 24, 96
TscAI CASTG 1 cut(s) 171
TseI GCWGC 1 cut(s) 172
TspDTI ATGAA 1 cut(s) 115
TspRI CASTG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.