Rh6AG299100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
49806822 .. 49809191
2370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG299100.1

Sequence Viewer

Length: 327 bp
ATGACGCCCATTTTCCTGAATCCTCCTGGCTCCTCCCTTTATAAAGATCATAATCTAAGCCAAAACATACACACACAAAAGCCAAAAGGGCAGAGGAAACAAAAACCTCGCAGGTCACAACTCCCCTACTACTTCAAAATGTCATCATCTTCAAGAATCCTTCTTTGCTTGTTCTTAGTGTTGCTCACTACTAGTCTACAGCACACAGAAGCAACCTTTGAGTCTTCACTGAGTGTTGACGAAGGACCTTGGGGTAAAACGGCTGCATTTGGGGGGGGCTTTTTAGCTTCCCCGCTTATAAGCAACAACACCCAAAGTGTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.06

Weight (kDa)

9.84

Isoelectric Point (pI)

64.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 42, 299
Acc36I ACCTGC 1 cut(s) 102
AccI GTMKAC 1 cut(s) 196
AciI CCGC 1 cut(s) 293
AcyI GRCGYC 1 cut(s) 5
AdeI CACNNNGTG 1 cut(s) 233
AgsI TTSAA 2 cut(s) 136, 153
AhlI ACTAGT 1 cut(s) 191
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 287
AluI AGCT 1 cut(s) 287
ApeKI GCWGC 1 cut(s) 263
AspS9I GGNCC 1 cut(s) 245
AvaII GGWCC 1 cut(s) 245
BbsI GAAGAC 1 cut(s) 216
BbvI GCAGC 1 cut(s) 250
BceAI ACGGC 1 cut(s) 276
BciT130I CCWGG 1 cut(s) 27
BcuI ACTAGT 1 cut(s) 191
BfaI CTAG 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 197
BfuAI ACCTGC 1 cut(s) 102
BglI GCCNNNNNGGC 1 cut(s) 88
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 245
BmgT120I GGNCC 1 cut(s) 245
BmiI GGNNCC 1 cut(s) 31
BmrFI CCNGG 1 cut(s) 27
BpiI GAAGAC 1 cut(s) 216
BsaBI GATNNNNATC 1 cut(s) 51
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 248
Bse8I GATNNNNATC 1 cut(s) 51
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 248
BseJI GATNNNNATC 1 cut(s) 51
BseMII CTCAG 1 cut(s) 221
BseRI GAGGAG 1 cut(s) 22
BseXI GCAGC 1 cut(s) 250
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 293
BspCNI CTCAG 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 31
BspMI ACCTGC 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 248
BssMI GATC 1 cut(s) 46
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 248
Bst2UI CCWGG 1 cut(s) 27
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 3 cut(s) 56, 175, 230
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BstSFI CTRYAG 1 cut(s) 197
BstV1I GCAGC 1 cut(s) 250
BstV2I GAAGAC 1 cut(s) 216
BtsIMutI CAGTG 1 cut(s) 227
BveI ACCTGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 245
CseI GACGC 1 cut(s) 13
CviJI RGCY 6 cut(s) 30, 60, 82, 263, 279, 287
CviKI_1 RGCY 6 cut(s) 30, 60, 82, 263, 279, 287
DdeI CTNAG 3 cut(s) 56, 175, 230
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
DraIII CACNNNGTG 1 cut(s) 233
Eco130I CCWWGG 1 cut(s) 248
Eco47I GGWCC 1 cut(s) 245
EcoO109I RGGNCCY 1 cut(s) 245
EcoRII CCWGG 1 cut(s) 25
EcoT14I CCWWGG 1 cut(s) 248
ErhI CCWWGG 1 cut(s) 248
FaiI YATR 4 cut(s) 42, 51, 68, 299
FauI CCCGC 1 cut(s) 300
FblI GTMKAC 1 cut(s) 196
Fnu4HI GCNGC 1 cut(s) 264
Fsp4HI GCNGC 1 cut(s) 264
FspBI CTAG 1 cut(s) 192
GluI GCNGC 1 cut(s) 264
HgaI GACGC 1 cut(s) 13
Hin1I GRCGYC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 238
HindII GTYRAC 1 cut(s) 238
HinfI GANTC 3 cut(s) 19, 156, 221
Hpy166II GTNNAC 2 cut(s) 197, 238
Hpy188III TCNNGA 2 cut(s) 16, 153
Hpy8I GTNNAC 2 cut(s) 197, 238
HpyAV CCTTC 2 cut(s) 170, 236
HpyCH4V TGCA 1 cut(s) 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 3 cut(s) 56, 175, 230
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 4 cut(s) 12, 29, 39, 97
Lsp1109I GCAGC 1 cut(s) 250
MaeI CTAG 1 cut(s) 192
MaeIII GTNAC 1 cut(s) 114
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 2 cut(s) 141, 216
MlyI GAGTC 1 cut(s) 230
MnlI CCTC 4 cut(s) 33, 43, 87, 117
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 88
NdeII GATC 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 31
NmuCI GTSAC 1 cut(s) 114
PfeI GAWTC 2 cut(s) 19, 156
PkrI GCNGC 1 cut(s) 265
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
PpuMI RGGWCCY 1 cut(s) 245
PsiI TTATAA 2 cut(s) 42, 299
Psp5II RGGWCCY 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 31
PspPI GGNCC 1 cut(s) 245
PspPPI RGGWCCY 1 cut(s) 245
SatI GCNGC 1 cut(s) 264
Sau3AI GATC 1 cut(s) 46
Sau96I GGNCC 1 cut(s) 245
SchI GAGTC 1 cut(s) 230
ScrFI CCNGG 1 cut(s) 27
SetI ASST 5 cut(s) 109, 116, 218, 250, 289
SfcI CTRYAG 1 cut(s) 197
SinI GGWCC 1 cut(s) 245
SpeI ACTAGT 1 cut(s) 191
SsiI CCGC 1 cut(s) 293
SspMI CTAG 1 cut(s) 192
StyD4I CCNGG 1 cut(s) 25
StyI CCWWGG 1 cut(s) 248
TfiI GAWTC 2 cut(s) 19, 156
TscAI CASTG 1 cut(s) 234
TseFI GTSAC 1 cut(s) 114
TseI GCWGC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 114
TspRI CASTG 1 cut(s) 234
VpaK11BI GGWCC 1 cut(s) 245
XmiI GTMKAC 1 cut(s) 196
XspI CTAG 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.