Rh6CG304900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
48531512 .. 48585312
53801 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG304900.1

Sequence Viewer

Length: 162 bp
ATGGTGCGCCAGTGGAGGGATGCTTTGACAAGTGCTGCAAATCTATCTGGGTTTGATTCTCACAAAATAAGGAAGGTAAGAAAAGATTATCCAGTGAAGCTGCAGGAGCTACAAATTGGAATGGCAGGTAAGAATCAGATGCGAAGAGCTGTCACGGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.07

Weight (kDa)

11.0

Isoelectric Point (pI)

47.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 16
AluBI AGCT 3 cut(s) 100, 109, 149
AluI AGCT 3 cut(s) 100, 109, 149
ApeKI GCWGC 2 cut(s) 35, 100
AspLEI GCGC 1 cut(s) 9
BbvI GCAGC 2 cut(s) 22, 87
BfmI CTRYAG 1 cut(s) 101
BfuAI ACCTGC 1 cut(s) 116
BisI GCNGC 2 cut(s) 36, 101
BlsI GCNGC 2 cut(s) 37, 102
BmsI GCATC 2 cut(s) 10, 129
Bsc4I CCNNNNNNNGG 1 cut(s) 16
Bse1I ACTGG 2 cut(s) 10, 92
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 16
BseNI ACTGG 2 cut(s) 10, 92
BseXI GCAGC 2 cut(s) 22, 87
BslI CCNNNNNNNGG 1 cut(s) 16
BspMAI CTGCAG 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 116
BspQI GCTCTTC 1 cut(s) 139
BsrI ACTGG 2 cut(s) 10, 92
Bst6I CTCTTC 1 cut(s) 139
BstF5I GGATG 1 cut(s) 25
BstHHI GCGC 1 cut(s) 9
BstMWI GCNNNNNNNGC 2 cut(s) 106, 155
BstSFI CTRYAG 1 cut(s) 101
BstV1I GCAGC 2 cut(s) 22, 87
BtsCI GGATG 1 cut(s) 25
BtsIMutI CAGTG 2 cut(s) 17, 99
BveI ACCTGC 1 cut(s) 116
CfoI GCGC 1 cut(s) 9
CviJI RGCY 4 cut(s) 100, 109, 149, 158
CviKI_1 RGCY 4 cut(s) 100, 109, 149, 158
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
Fnu4HI GCNGC 2 cut(s) 36, 101
FokI GGATG 1 cut(s) 32
Fsp4HI GCNGC 2 cut(s) 36, 101
GlaI GCGC 1 cut(s) 8
GluI GCNGC 2 cut(s) 36, 101
HhaI GCGC 1 cut(s) 9
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HinfI GANTC 2 cut(s) 56, 133
Hpy188I TCNGA 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 67
HpyCH4V TGCA 2 cut(s) 38, 103
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 155
HspAI GCGC 1 cut(s) 7
LguI GCTCTTC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 5 cut(s) 23, 33, 89, 105, 111
Lsp1109I GCAGC 2 cut(s) 22, 87
LweI GCATC 2 cut(s) 10, 129
MaeIII GTNAC 1 cut(s) 151
MboII GAAGA 1 cut(s) 156
MluCI AATT 1 cut(s) 114
MnlI CCTC 1 cut(s) 9
MwoI GCNNNNNNNGC 2 cut(s) 106, 155
NmuCI GTSAC 1 cut(s) 151
PciSI GCTCTTC 1 cut(s) 139
PfeI GAWTC 2 cut(s) 56, 133
PkrI GCNGC 2 cut(s) 37, 102
PstI CTGCAG 1 cut(s) 105
SapI GCTCTTC 1 cut(s) 139
SatI GCNGC 2 cut(s) 36, 101
SetI ASST 5 cut(s) 78, 102, 111, 130, 151
SfaNI GCATC 2 cut(s) 10, 129
SfcI CTRYAG 1 cut(s) 101
SgeI CNNG 6 cut(s) 22, 42, 60, 104, 116, 138
Sse9I AATT 1 cut(s) 114
TasI AATT 1 cut(s) 114
TfiI GAWTC 2 cut(s) 56, 133
TscAI CASTG 2 cut(s) 17, 99
TseFI GTSAC 1 cut(s) 151
TseI GCWGC 2 cut(s) 35, 100
Tsp45I GTSAC 1 cut(s) 151
TspRI CASTG 2 cut(s) 17, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.