RchiOBHm_Chr7g0215691

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
33366875 .. 33368395
1521 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19299

Sequence Viewer

Length: 165 bp
ATGAGTTCAAAATCCCTCTGCGAATTTCAGCATTGGTGGATAACACACAGTCACATCATGAAAAGGAAATTAAGATATACTAAGGGATCCATTCACTTCCCAATTGTCATGACTGAGACACAAAGAGGAAGACTTGAGAAATACAAAGGCCACTTGAATAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.61

Weight (kDa)

10.45

Isoelectric Point (pI)

33.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 81, 94
AcsI RAATTY 1 cut(s) 23
AgsI TTSAA 2 cut(s) 9, 157
Alw26I GTCTC 1 cut(s) 110
AlwI GGATC 2 cut(s) 81, 94
AoxI GGCC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 23
BamHI GGATCC 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 88
BpiI GAAGAC 1 cut(s) 136
BpuEI CTTGAG 1 cut(s) 155
BseMII CTCAG 1 cut(s) 105
BshFI GGCC 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 110
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 86
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 106
BspHI TCATGA 2 cut(s) 57, 108
BspLI GGNNCC 1 cut(s) 88
BspPI GGATC 2 cut(s) 81, 94
BssMI GATC 1 cut(s) 86
Bst4CI ACNGT 1 cut(s) 50
BstDEI CTNAG 2 cut(s) 81, 114
BstKTI GATC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BsuRI GGCC 1 cut(s) 150
CciI TCATGA 2 cut(s) 57, 108
CviAII CATG 2 cut(s) 58, 109
CviJI RGCY 1 cut(s) 150
CviKI_1 RGCY 1 cut(s) 150
DdeI CTNAG 2 cut(s) 81, 114
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
FaeI CATG 2 cut(s) 61, 112
FaiI YATR 3 cut(s) 59, 78, 110
FatI CATG 2 cut(s) 57, 108
HaeIII GGCC 1 cut(s) 150
Hin1II CATG 2 cut(s) 61, 112
Hpy188III TCNNGA 2 cut(s) 58, 109
HpyCH4III ACNGT 1 cut(s) 50
HpyF3I CTNAG 2 cut(s) 81, 114
Hsp92II CATG 2 cut(s) 61, 112
Kzo9I GATC 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MboII GAAGA 1 cut(s) 141
MfeI CAATTG 1 cut(s) 102
MflI RGATCY 1 cut(s) 86
MluCI AATT 3 cut(s) 23, 68, 102
MnlI CCTC 2 cut(s) 26, 119
MseI TTAA 1 cut(s) 71
MunI CAATTG 1 cut(s) 102
NdeII GATC 1 cut(s) 86
NlaIII CATG 2 cut(s) 61, 112
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 50
PagI TCATGA 2 cut(s) 57, 108
PspN4I GGNNCC 1 cut(s) 88
PsuI RGATCY 1 cut(s) 86
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 1 cut(s) 86
SgeI CNNG 3 cut(s) 70, 121, 146
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 3 cut(s) 23, 68, 102
TaaI ACNGT 1 cut(s) 50
TasI AATT 3 cut(s) 23, 68, 102
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 74
XapI RAATTY 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.