Rh6BG190000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
35300952 .. 35304897
3946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG190000.1

Sequence Viewer

Length: 189 bp
ATGCCAATTCTCGCGGATCTCATTTTCGTAGAAGTATATATAAGCCTCAAGTTCAACCCAGCATCTGTCGCATTCGAGAAGCCTCCATCGCTATCTAGAGTTCCTGTTAATGGACAACAGGCTTCCAGTCAAAATCAAGATCAGGAAAATCTCGGTAAGCGTCGCATTTCGTATCATCGTTCTATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.99

Weight (kDa)

9.39

Isoelectric Point (pI)

67.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 14
AciI CCGC 1 cut(s) 14
AclWI GGATC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 55
AlwI GGATC 1 cut(s) 24
AlwNI CAGNNNCTG 1 cut(s) 65
BccI CCATC 1 cut(s) 94
BfaI CTAG 1 cut(s) 96
BmsI GCATC 1 cut(s) 71
BpuEI CTTGAG 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 126
BseYI CCCAGC 1 cut(s) 58
Bsh1236I CGCG 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 110
BsmI GAATGC 1 cut(s) 71
Bsp143I GATC 2 cut(s) 16, 139
BspACI CCGC 1 cut(s) 14
BspFNI CGCG 1 cut(s) 14
BspPI GGATC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 126
BssMI GATC 2 cut(s) 16, 139
BstFNI CGCG 1 cut(s) 14
BstKTI GATC 2 cut(s) 19, 142
BstMBI GATC 2 cut(s) 16, 139
BstMWI GCNNNNNNNGC 2 cut(s) 68, 88
BstUI CGCG 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 16
BstYI RGATCY 1 cut(s) 16
BtgZI GCGATG 1 cut(s) 72
CaiI CAGNNNCTG 1 cut(s) 65
CseI GACGC 1 cut(s) 149
CviJI RGCY 3 cut(s) 45, 82, 122
CviKI_1 RGCY 3 cut(s) 45, 82, 122
DpnI GATC 2 cut(s) 18, 141
DpnII GATC 2 cut(s) 16, 139
FaiI YATR 3 cut(s) 37, 39, 41
FspBI CTAG 1 cut(s) 96
GsaI CCCAGC 1 cut(s) 62
HgaI GACGC 1 cut(s) 149
Hpy188III TCNNGA 4 cut(s) 76, 96, 137, 143
Hpy99I CGWCG 1 cut(s) 165
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 88
Kzo9I GATC 2 cut(s) 16, 139
LpnPI CCDG 5 cut(s) 72, 104, 117, 128, 139
LweI GCATC 1 cut(s) 71
MaeI CTAG 1 cut(s) 96
MalI GATC 2 cut(s) 18, 141
MboI GATC 2 cut(s) 16, 139
MflI RGATCY 1 cut(s) 16
MluCI AATT 1 cut(s) 6
MnlI CCTC 2 cut(s) 56, 93
MseI TTAA 1 cut(s) 108
Mva1269I GAATGC 1 cut(s) 71
MvnI CGCG 1 cut(s) 14
MwoI GCNNNNNNNGC 2 cut(s) 68, 88
NdeII GATC 2 cut(s) 16, 139
PctI GAATGC 1 cut(s) 71
PspFI CCCAGC 1 cut(s) 58
PstNI CAGNNNCTG 1 cut(s) 65
PsuI RGATCY 1 cut(s) 16
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 2 cut(s) 16, 139
SfaNI GCATC 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 6
SsiI CCGC 1 cut(s) 14
SspMI CTAG 1 cut(s) 96
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 6
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
XbaI TCTAGA 1 cut(s) 95
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.