Rh6BG109200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
17083922 .. 17085275
1354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG109200.1

Sequence Viewer

Length: 369 bp
ATGAGTCTTTTTCGTGAAAGATTTGTTGGGTTGTTTGTGATTGTTTGGTTCACTGTTGAATCCCAAGGTTTGAGATTTTTTTTATATCTGGGTTTTGTTCTTCTGCTGTTAACGTTTGAATCTATCACATTCGAGAAGCCTCCATCGCTATCTAGAGTTCCTGTTAACGGACAACAGACTTCCAGTCAAAATCAAGATCAGGAAAATCTCGCTGATCAGCAGATACCGTTTATCAGTAGCAACGTCAATTGTATTGCTCATCTATTTAGTCTGCTTTCAAGTATGAAACAAACTATTGCAAGATACAACAAGTGTGACGAGTCTTCAGAGATCGCTTTGGTAGAATCAATCGCAGAGGGACTGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.86

Weight (kDa)

4.84

Isoelectric Point (pI)

50.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 309
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 3 cut(s) 59, 119, 279
AhdI GACNNNNNGTC 1 cut(s) 183
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
BbsI GAAGAC 1 cut(s) 315
BccI CCATC 1 cut(s) 151
BclI TGATCA 1 cut(s) 214
BfaI CTAG 1 cut(s) 153
BmeRI GACNNNNNGTC 1 cut(s) 183
BpiI GAAGAC 1 cut(s) 315
BsaJI CCNNGG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 183
BseDI CCNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 167
Bsp143I GATC 3 cut(s) 196, 214, 330
BsrI ACTGG 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 3 cut(s) 196, 214, 330
BssT1I CCWWGG 1 cut(s) 64
Bst4CI ACNGT 3 cut(s) 55, 228, 363
BstKTI GATC 3 cut(s) 199, 217, 333
BstMBI GATC 3 cut(s) 196, 214, 330
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstV2I GAAGAC 1 cut(s) 315
BtgZI GCGATG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 51
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
DpnI GATC 3 cut(s) 198, 216, 332
DpnII GATC 3 cut(s) 196, 214, 330
DriI GACNNNNNGTC 1 cut(s) 183
Eam1105I GACNNNNNGTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 64
Eco57I CTGAAG 1 cut(s) 309
EcoT14I CCWWGG 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 64
FaiI YATR 2 cut(s) 85, 284
FbaI TGATCA 1 cut(s) 214
FspBI CTAG 1 cut(s) 153
HincII GTYRAC 2 cut(s) 111, 166
HindII GTYRAC 2 cut(s) 111, 166
HinfI GANTC 5 cut(s) 4, 59, 119, 320, 344
HpaI GTTAAC 2 cut(s) 111, 166
Hpy166II GTNNAC 3 cut(s) 51, 111, 166
Hpy188I TCNGA 2 cut(s) 328, 368
Hpy188III TCNNGA 5 cut(s) 14, 133, 153, 194, 200
Hpy8I GTNNAC 3 cut(s) 51, 111, 166
HpyCH4III ACNGT 3 cut(s) 55, 228, 363
HpyCH4IV ACGT 2 cut(s) 113, 243
HpyCH4V TGCA 1 cut(s) 299
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpySE526I ACGT 2 cut(s) 113, 243
Ksp22I TGATCA 1 cut(s) 214
KspAI GTTAAC 2 cut(s) 111, 166
Kzo9I GATC 3 cut(s) 196, 214, 330
LpnPI CCDG 4 cut(s) 74, 174, 185, 196
MaeI CTAG 1 cut(s) 153
MaeII ACGT 2 cut(s) 113, 243
MaeIII GTNAC 1 cut(s) 314
MalI GATC 3 cut(s) 198, 216, 332
MboI GATC 3 cut(s) 196, 214, 330
MboII GAAGA 2 cut(s) 92, 315
MfeI CAATTG 1 cut(s) 247
MluCI AATT 1 cut(s) 247
MlyI GAGTC 2 cut(s) 13, 329
MnlI CCTC 2 cut(s) 150, 349
MseI TTAA 2 cut(s) 110, 165
MunI CAATTG 1 cut(s) 247
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 3 cut(s) 196, 214, 330
NmuCI GTSAC 1 cut(s) 314
PfeI GAWTC 3 cut(s) 59, 119, 344
PleI GAGTC 2 cut(s) 12, 328
PpsI GAGTC 2 cut(s) 12, 328
Psp1406I AACGTT 1 cut(s) 113
SaqAI TTAA 2 cut(s) 110, 165
Sau3AI GATC 3 cut(s) 196, 214, 330
SchI GAGTC 2 cut(s) 13, 329
SetI ASST 3 cut(s) 70, 116, 246
Sse9I AATT 1 cut(s) 247
SspMI CTAG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 64
TaaI ACNGT 3 cut(s) 55, 228, 363
TaiI ACGT 2 cut(s) 116, 246
TaqI TCGA 1 cut(s) 132
TasI AATT 1 cut(s) 247
TfiI GAWTC 3 cut(s) 59, 119, 344
Tru1I TTAA 2 cut(s) 110, 165
Tru9I TTAA 2 cut(s) 110, 165
TscAI CASTG 1 cut(s) 58
TseFI GTSAC 1 cut(s) 314
Tsp45I GTSAC 1 cut(s) 314
TspDTI ATGAA 1 cut(s) 299
TspGWI ACGGA 1 cut(s) 183
TspRI CASTG 1 cut(s) 58
XbaI TCTAGA 1 cut(s) 152
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.