RLG00000013555

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
33083059 .. 33087833
4775 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000013555

Sequence Viewer

Length: 357 bp
ATGCCTCACAACCAAGTTCTCAAGAACTTGTTGGTTAGAATTCGAGAAGCCTCAACCCAGCATCTATCGCATTCGAGAAGCCTCCATCGCTATCTAGAGTTCCTGTTAACGGACAACAGGCTTCCAGTCAAAATCAAGATCAGGAAAATCTCACTGATCAGCAGATACCGTTTATCAGTAGCAAGGTCAATTGTTATTCAGTCTGCTATCAAGTATGAAACAAACTATTGCAAGATACAACAAGATTTTATACTCACTGACAGTGTTAATGTTGTTTCAGATAGGGAAAGCTTTTTTGAAGCTGCTGAAAGTGTTCCTGGGTTAATGCCATGGAGATTGATGAATGAGCTTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.86

Weight (kDa)

9.83

Isoelectric Point (pI)

34.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 299
AjnI CCWGG 1 cut(s) 316
AluBI AGCT 3 cut(s) 291, 302, 349
AluI AGCT 3 cut(s) 291, 302, 349
ApeKI GCWGC 1 cut(s) 302
ApoI RAATTY 1 cut(s) 39
Asp700I GAANNNNTTC 1 cut(s) 312
BbvI GCAGC 1 cut(s) 289
BccI CCATC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 318
BclI TGATCA 1 cut(s) 156
BfaI CTAG 1 cut(s) 95
BisI GCNGC 1 cut(s) 303
BlsI GCNGC 1 cut(s) 304
Bme1390I CCNGG 1 cut(s) 318
BmrFI CCNGG 1 cut(s) 318
BmsI GCATC 1 cut(s) 70
BpuEI CTTGAG 1 cut(s) 5
BsaJI CCNNGG 2 cut(s) 317, 329
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 318
BseDI CCNNGG 2 cut(s) 317, 329
BseLI CCNNNNNNNGG 1 cut(s) 109
BseNI ACTGG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 289
BseYI CCCAGC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 109
BsmI GAATGC 1 cut(s) 70
Bsp143I GATC 2 cut(s) 138, 156
Bsp19I CCATGG 1 cut(s) 329
BsrI ACTGG 1 cut(s) 125
BssECI CCNNGG 2 cut(s) 317, 329
BssMI GATC 2 cut(s) 138, 156
BssT1I CCWWGG 1 cut(s) 329
Bst2UI CCWGG 1 cut(s) 318
Bst4CI ACNGT 2 cut(s) 170, 263
BstDSI CCRYGG 1 cut(s) 329
BstKTI GATC 2 cut(s) 141, 159
BstMBI GATC 2 cut(s) 138, 156
BstMWI GCNNNNNNNGC 2 cut(s) 67, 87
BstNI CCWGG 1 cut(s) 318
BstSCI CCNGG 1 cut(s) 316
BstV1I GCAGC 1 cut(s) 289
BtgI CCRYGG 1 cut(s) 329
BtgZI GCGATG 1 cut(s) 71
BtsIMutI CAGTG 3 cut(s) 152, 255, 268
CviAII CATG 1 cut(s) 330
CviJI RGCY 6 cut(s) 50, 81, 121, 291, 302, 349
CviKI_1 RGCY 6 cut(s) 50, 81, 121, 291, 302, 349
DpnI GATC 2 cut(s) 140, 158
DpnII GATC 2 cut(s) 138, 156
Eco130I CCWWGG 1 cut(s) 329
EcoRI GAATTC 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 316
EcoT14I CCWWGG 1 cut(s) 329
ErhI CCWWGG 1 cut(s) 329
FaeI CATG 1 cut(s) 333
FaiI YATR 3 cut(s) 216, 251, 331
FatI CATG 1 cut(s) 329
FbaI TGATCA 1 cut(s) 156
Fnu4HI GCNGC 1 cut(s) 303
Fsp4HI GCNGC 1 cut(s) 303
FspBI CTAG 1 cut(s) 95
GluI GCNGC 1 cut(s) 303
GsaI CCCAGC 1 cut(s) 61
Hin1II CATG 1 cut(s) 333
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 289
HpaI GTTAAC 1 cut(s) 108
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 1 cut(s) 280
Hpy188III TCNNGA 6 cut(s) 22, 44, 75, 95, 136, 142
Hpy8I GTNNAC 1 cut(s) 108
HpyCH4III ACNGT 2 cut(s) 170, 263
HpyCH4V TGCA 1 cut(s) 231
HpyF10VI GCNNNNNNNGC 2 cut(s) 67, 87
Hsp92II CATG 1 cut(s) 333
Ksp22I TGATCA 1 cut(s) 156
KspAI GTTAAC 1 cut(s) 108
Kzo9I GATC 2 cut(s) 138, 156
LpnPI CCDG 7 cut(s) 71, 103, 116, 127, 138, 303, 330
Lsp1109I GCAGC 1 cut(s) 289
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 95
MalI GATC 2 cut(s) 140, 158
MboI GATC 2 cut(s) 138, 156
MfeI CAATTG 1 cut(s) 189
MluCI AATT 2 cut(s) 39, 189
MnlI CCTC 3 cut(s) 15, 61, 92
MroXI GAANNNNTTC 1 cut(s) 312
MseI TTAA 4 cut(s) 107, 267, 323, 355
MspR9I CCNGG 1 cut(s) 318
MunI CAATTG 1 cut(s) 189
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 318
MwoI GCNNNNNNNGC 2 cut(s) 67, 87
NcoI CCATGG 1 cut(s) 329
NdeII GATC 2 cut(s) 138, 156
NlaIII CATG 1 cut(s) 333
PctI GAATGC 1 cut(s) 70
PdmI GAANNNNTTC 1 cut(s) 312
PkrI GCNGC 1 cut(s) 304
Psp6I CCWGG 1 cut(s) 316
PspFI CCCAGC 1 cut(s) 57
PspGI CCWGG 1 cut(s) 316
SaqAI TTAA 4 cut(s) 107, 267, 323, 355
SatI GCNGC 1 cut(s) 303
Sau3AI GATC 2 cut(s) 138, 156
ScrFI CCNGG 1 cut(s) 318
SetI ASST 4 cut(s) 188, 293, 304, 351
SfaNI GCATC 1 cut(s) 70
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
Sse9I AATT 2 cut(s) 39, 189
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 316
StyI CCWWGG 1 cut(s) 329
TaaI ACNGT 2 cut(s) 170, 263
TaqI TCGA 2 cut(s) 43, 74
TasI AATT 2 cut(s) 39, 189
Tru1I TTAA 4 cut(s) 107, 267, 323, 355
Tru9I TTAA 4 cut(s) 107, 267, 323, 355
TscAI CASTG 3 cut(s) 159, 262, 268
TseI GCWGC 1 cut(s) 302
TspDTI ATGAA 3 cut(s) 231, 341, 356
TspGWI ACGGA 1 cut(s) 125
TspRI CASTG 3 cut(s) 159, 262, 268
XapI RAATTY 1 cut(s) 39
XbaI TCTAGA 1 cut(s) 94
XmnI GAANNNNTTC 1 cut(s) 312
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.