RchiOBHm_Chr7g0243831

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
70113335 .. 70118333
4999 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21854

Sequence Viewer

Length: 201 bp
ATGGAATCTGGCCAAATTCACTTTAGAATTCACCCCGTTAATTTACTCAAACCCAGGTATCTTCTCCTTGAGAAAGAAACCGAGTTTTATCGATGTGCTCTGATGCTTAATCACCCATCGCATCACGTACTGACTCCGATCTATAGCTTTTCTTCCTTGAGTAGTCTTCTTCTGTTGTTCTCAAGTGCTTATGAAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.75

Weight (kDa)

7.97

Isoelectric Point (pI)

28.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 10
AcsI RAATTY 2 cut(s) 15, 27
AfaI GTAC 1 cut(s) 129
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Alw21I GWGCWC 1 cut(s) 100
AoxI GGCC 1 cut(s) 10
ApoI RAATTY 2 cut(s) 15, 27
AsuHPI GGTGA 2 cut(s) 23, 104
BaeI ACNNNNGTAYC 2 cut(s) 41, 74
BalI TGGCCA 1 cut(s) 12
BbsI GAAGAC 1 cut(s) 158
Bbv12I GWGCWC 1 cut(s) 100
BccI CCATC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 2 cut(s) 93, 130
BpiI GAAGAC 1 cut(s) 158
BpuEI CTTGAG 3 cut(s) 89, 166, 178
Bsa29I ATCGAT 1 cut(s) 91
BsaAI YACGTR 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 55
BseCI ATCGAT 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 53
BshFI GGCC 1 cut(s) 12
BshVI ATCGAT 1 cut(s) 91
BsiHKAI GWGCWC 1 cut(s) 100
BsnI GGCC 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 138
BspANI GGCC 1 cut(s) 12
BspDI ATCGAT 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 55
BstBAI YACGTR 1 cut(s) 127
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 158
Bsu15I ATCGAT 1 cut(s) 91
BsuRI GGCC 1 cut(s) 12
BsuTUI ATCGAT 1 cut(s) 91
BtgZI GCGATG 1 cut(s) 102
ClaI ATCGAT 1 cut(s) 91
Csp6I GTAC 1 cut(s) 128
CviJI RGCY 2 cut(s) 12, 147
CviKI_1 RGCY 2 cut(s) 12, 147
CviQI GTAC 1 cut(s) 128
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EaeI YGGCCR 1 cut(s) 10
EcoRI GAATTC 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 53
FaiI YATR 2 cut(s) 144, 192
HaeIII GGCC 1 cut(s) 12
HinfI GANTC 2 cut(s) 5, 133
HphI GGTGA 2 cut(s) 23, 104
Hpy188I TCNGA 2 cut(s) 102, 138
HpyCH4IV ACGT 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 126
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 2 cut(s) 40, 67
LweI GCATC 2 cut(s) 93, 130
MaeII ACGT 1 cut(s) 126
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 4 cut(s) 53, 144, 158, 161
MhlI GDGCHC 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 12
MluCI AATT 3 cut(s) 15, 27, 40
MluNI TGGCCA 1 cut(s) 12
MlyI GAGTC 1 cut(s) 127
Mox20I TGGCCA 1 cut(s) 12
MscI TGGCCA 1 cut(s) 12
MseI TTAA 2 cut(s) 39, 108
Msp20I TGGCCA 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
NdeII GATC 1 cut(s) 138
PfeI GAWTC 1 cut(s) 5
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
Ppu21I YACGTR 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
SaqAI TTAA 2 cut(s) 39, 108
Sau3AI GATC 1 cut(s) 138
SchI GAGTC 1 cut(s) 127
ScrFI CCNGG 1 cut(s) 55
SduI GDGCHC 1 cut(s) 100
SetI ASST 3 cut(s) 59, 129, 149
SfaNI GCATC 2 cut(s) 93, 130
SfcI CTRYAG 1 cut(s) 142
SgeI CNNG 9 cut(s) 21, 47, 66, 67, 80, 94, 137, 169, 195
SmlI CTYRAG 3 cut(s) 68, 157, 181
SmoI CTYRAG 3 cut(s) 68, 157, 181
Sse9I AATT 3 cut(s) 15, 27, 40
StyD4I CCNGG 1 cut(s) 53
TaiI ACGT 1 cut(s) 129
TaqI TCGA 1 cut(s) 91
TasI AATT 3 cut(s) 15, 27, 40
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 39, 108
Tru9I TTAA 2 cut(s) 39, 108
XapI RAATTY 2 cut(s) 15, 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.