RLG00000009223

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0009584
Physical Location & Seq
Forward (+)
49251625 .. 49253202
1578 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000009223

Sequence Viewer

Length: 411 bp
ATGGCAAATCCTCACATTCAGGTAGCTAAGAAGTTTACCGAGCCATACATAGCTCAGCTTATGATGGCGATAGATGAGGCTACAATGGTGACAAGAACCCATTTAGCTAACATACACATTACCTTGAAGCCATATACAAAGCAAGTACTCCACGCATGCAGAAAATTCATCAAATCTGCAACTTTATACCATCATGAGGTCCAAGAAATGCTCAAAAACAATACGTTGACACAATCACTTGCAACTATCGAACTGGCATGGCTTCTGGCCACTGCTTTACTGGCCGTGCCTGCAGTTCTTATGTTTAAGTTGGCTTCCGTTATTTTCAGAAAAAAGGCAAATAAGCGTATTCATAGATCCTATGCATATCATACATGCCGCAAGCTCAAGCGTGCTCATCCTGACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.66

Weight (kDa)

10.14

Isoelectric Point (pI)

44.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 379
AclWI GGATC 1 cut(s) 351
AcoI YGGCCR 2 cut(s) 267, 282
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 5 cut(s) 26, 53, 58, 107, 385
AluI AGCT 5 cut(s) 26, 53, 58, 107, 385
Alw21I GWGCWC 1 cut(s) 397
AlwI GGATC 1 cut(s) 351
AoxI GGCC 2 cut(s) 267, 282
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 199
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 199
BalI TGGCCA 1 cut(s) 269
Bbv12I GWGCWC 1 cut(s) 397
BccI CCATC 2 cut(s) 58, 198
BceAI ACGGC 1 cut(s) 269
BfmI CTRYAG 1 cut(s) 291
BisI GCNGC 1 cut(s) 379
BlpI GCTNAGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 380
BmcAI AGTACT 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
Bpu1102I GCTNAGC 1 cut(s) 54
BpuEI CTTGAG 1 cut(s) 371
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 2 cut(s) 258, 285
BseGI GGATG 1 cut(s) 397
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 68
BseNI ACTGG 2 cut(s) 258, 285
BshFI GGCC 2 cut(s) 269, 284
BsiHKAI GWGCWC 1 cut(s) 397
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 2 cut(s) 269, 284
Bsp1286I GDGCHC 1 cut(s) 397
Bsp143I GATC 1 cut(s) 356
Bsp1720I GCTNAGC 1 cut(s) 54
BspACI CCGC 1 cut(s) 379
BspANI GGCC 2 cut(s) 269, 284
BspCNI CTCAG 1 cut(s) 67
BspHI TCATGA 1 cut(s) 193
BspMAI CTGCAG 1 cut(s) 295
BspPI GGATC 1 cut(s) 351
BsrI ACTGG 2 cut(s) 258, 285
BssMI GATC 1 cut(s) 356
BstC8I GCNNGC 4 cut(s) 157, 291, 383, 393
BstDEI CTNAG 2 cut(s) 27, 54
BstF5I GGATG 1 cut(s) 397
BstKTI GATC 1 cut(s) 359
BstMBI GATC 1 cut(s) 356
BstMWI GCNNNNNNNGC 2 cut(s) 281, 290
BstNSI RCATGY 2 cut(s) 159, 378
BstSFI CTRYAG 1 cut(s) 291
BstX2I RGATCY 1 cut(s) 356
BstYI RGATCY 1 cut(s) 356
BsuRI GGCC 2 cut(s) 269, 284
BtsCI GGATG 1 cut(s) 397
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cac8I GCNNGC 4 cut(s) 157, 291, 383, 393
CciI TCATGA 1 cut(s) 193
Cfr13I GGNCC 1 cut(s) 199
Csp6I GTAC 1 cut(s) 146
CviAII CATG 4 cut(s) 156, 194, 258, 375
CviQI GTAC 1 cut(s) 146
DdeI CTNAG 2 cut(s) 27, 54
DpnI GATC 1 cut(s) 358
DpnII GATC 1 cut(s) 356
EaeI YGGCCR 2 cut(s) 267, 282
Eco47I GGWCC 1 cut(s) 199
EcoT22I ATGCAT 1 cut(s) 367
FaeI CATG 4 cut(s) 159, 197, 261, 378
FatI CATG 4 cut(s) 155, 193, 257, 374
Fnu4HI GCNGC 1 cut(s) 379
FokI GGATG 1 cut(s) 384
Fsp4HI GCNGC 1 cut(s) 379
GluI GCNGC 1 cut(s) 379
HaeIII GGCC 2 cut(s) 269, 284
Hin1II CATG 4 cut(s) 159, 197, 261, 378
HincII GTYRAC 1 cut(s) 228
HindII GTYRAC 1 cut(s) 228
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 2 cut(s) 36, 228
Hpy188I TCNGA 1 cut(s) 329
Hpy188III TCNNGA 2 cut(s) 194, 401
Hpy8I GTNNAC 2 cut(s) 36, 228
HpyCH4IV ACGT 1 cut(s) 224
HpyCH4V TGCA 5 cut(s) 159, 179, 242, 293, 365
HpyF10VI GCNNNNNNNGC 2 cut(s) 281, 290
HpyF3I CTNAG 2 cut(s) 27, 54
HpySE526I ACGT 1 cut(s) 224
Hsp92II CATG 4 cut(s) 159, 197, 261, 378
Kzo9I GATC 1 cut(s) 356
LpnPI CCDG 5 cut(s) 5, 239, 251, 266, 303
MaeII ACGT 1 cut(s) 224
MaeIII GTNAC 1 cut(s) 88
MalI GATC 1 cut(s) 358
MboI GATC 1 cut(s) 356
MflI RGATCY 1 cut(s) 356
MhlI GDGCHC 1 cut(s) 397
MlsI TGGCCA 1 cut(s) 269
MluCI AATT 1 cut(s) 164
MluNI TGGCCA 1 cut(s) 269
MnlI CCTC 3 cut(s) 21, 70, 190
Mox20I TGGCCA 1 cut(s) 269
Mph1103I ATGCAT 1 cut(s) 367
MscI TGGCCA 1 cut(s) 269
MseI TTAA 1 cut(s) 306
Msp20I TGGCCA 1 cut(s) 269
MwoI GCNNNNNNNGC 2 cut(s) 281, 290
NdeII GATC 1 cut(s) 356
NlaIII CATG 4 cut(s) 159, 197, 261, 378
NmuCI GTSAC 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 367
NspI RCATGY 2 cut(s) 159, 378
PaeI GCATGC 1 cut(s) 159
PagI TCATGA 1 cut(s) 193
PkrI GCNGC 1 cut(s) 380
PspPI GGNCC 1 cut(s) 199
PstI CTGCAG 1 cut(s) 295
PsuI RGATCY 1 cut(s) 356
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 306
SatI GCNGC 1 cut(s) 379
Sau3AI GATC 1 cut(s) 356
Sau96I GGNCC 1 cut(s) 199
ScaI AGTACT 1 cut(s) 147
SduI GDGCHC 1 cut(s) 397
SetI ASST 9 cut(s) 24, 28, 55, 60, 109, 125, 201, 227, 387
SfcI CTRYAG 1 cut(s) 291
SinI GGWCC 1 cut(s) 199
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
SphI GCATGC 1 cut(s) 159
Sse9I AATT 1 cut(s) 164
SsiI CCGC 1 cut(s) 379
TaiI ACGT 1 cut(s) 227
TaqI TCGA 1 cut(s) 249
TasI AATT 1 cut(s) 164
TatI WGTACW 1 cut(s) 145
TauI GCSGC 1 cut(s) 381
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TscAI CASTG 1 cut(s) 277
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 157, 341
TspGWI ACGGA 1 cut(s) 307
TspRI CASTG 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 164
XceI RCATGY 2 cut(s) 159, 378
XcmI CCANNNNNNNNNTGG 1 cut(s) 277
ZrmI AGTACT 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.