Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4A

Orthogroup ID

OG0009584

Physical Location & Seq

Genomic Coordinates Reverse (-)

20828985 .. 20834774

Gene Structure 5790 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4AG097500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 921 bp

ATGGAAGCCTCCATGCTTTTCGTCTTCTCCATATTCTCAGTCCTATTATTCAACGGAATCACGGCAGAGCCACCGCTTCTGAACGACGGGTCTCCGGAGGTTGCAGATTCGCCGATAAGACTCCAACTCCAACTTCGGTTGCTGGAGACCAAGGTTTACCTTCTAGAATCAAGCATTGATGAGAAAAACCGTGAACTCAGGAAAAAGGATGAAAAAATTAGGCAGATGGAGGAGATTATTCAAGGGAAATCAAACAGCAATGCATTTTTCCAAAGTGAGACAGAGGCTGTCCAGGGAAGAGAATTTTTAGATGCTATGCAATTCACAGATGAGTTACGTGAGAAGAATCCTGAGGAGCTAGTGAATCAGGCATTAGAAATGAAAGCTCAGGTTAATAGTTTGGCTCAGCTCAGCATTGAAACAATCAAATCTAAATGGATACCAGGTTTGAAGAAACAATCTTTAGAAATTGTAGCCTATCTTGAACCAAATATTCAATTACTCACTGCAAAAACTGTTGATATCTACCATTCGTCAAAGAGTTCTGTAGCACTATTTGTTTTCAAGGCACAAGAAATGGCAAATCCTCACATTCAGGTAGCTAACAAGTTTACCCAGCCATACATAGCTCAGCTTATGATGGCGATAGATGAGGCTACAACGGTGACAAAAACCCATTTAGCTAACATACACGTTACCTTGAAGCCATATACAAAGCAAGTACTCCACGCATGCAGAAAATTCATCAAATCTGCAACTTTTTACCATCATGAGGTCCAAGAAATGCTCAAAAACAATACGTTGACACAATCACTTGCAACTATCGAACTGGCATGGCTTCTGGCCACTGCTTTACTGGCCCTGCCTGCAGTTCTTATGTTTAAGTTGACTTCTGTTATTTTCAGAAAAAAAGGCAAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

306

Amino Acids

34.75

Weight (kDa)

7.79

Isoelectric Point (pI)

40.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009584)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G30090
fragaria_vesca	FvH4_4g07490 FvH4_4g07490 FvH4_4g07490
malus_domestica	MD16G1251700.v1.1
prunus_persica	Prupe.1G078300_v2.0.a1 Prupe.1G078300_v2.0.a1 Prupe.1G078300_v2.0.a1 Prupe.1G078300_v2.0.a1 Prupe.1G078300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0399971
rosa_laevigata	RLG00000009223
rosa_roxburghii	Rroxscaffold_5G00344870 Rroxscaffold_5G00344890
rosa_rugosa	Rorug04G0021900
rosa_samantha	Rh4AG097500 Rh4BG095400 Rh4BG095500 Rh4CG106700 Rh4DG092400
rosa_wichuraiana	Rw4G008080 Rw4G008090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	94
AciI	CCGC	1 cut(s)	74
AcoI	YGGCCR	1 cut(s)	843
AcsI	RAATTY	2 cut(s)	302, 740
AfaI	GTAC	1 cut(s)	723
AfiI	CCNNNNNNNGG	1 cut(s)	772
AflIII	ACRYGT	1 cut(s)	691
AgsI	TTSAA	8 cut(s)	52, 242, 419, 451, 485, 497, 565, 703
AjnI	CCWGG	2 cut(s)	291, 442
AjuI	GAANNNNNNNTTGG	2 cut(s)	117, 149
AluBI	AGCT	7 cut(s)	358, 386, 409, 602, 629, 634, 683
AluI	AGCT	7 cut(s)	358, 386, 409, 602, 629, 634, 683
Alw26I	GTCTC	3 cut(s)	96, 140, 272
AlwNI	CAGNNNCTG	1 cut(s)	287
Aor13HI	TCCGGA	1 cut(s)	94
AoxI	GGCC	2 cut(s)	843, 858
ApoI	RAATTY	2 cut(s)	302, 740
AspS9I	GGNCC	2 cut(s)	775, 859
AsuHPI	GGTGA	1 cut(s)	676
AvaII	GGWCC	1 cut(s)	775
AxyI	CCTNAGG	1 cut(s)	351
BalI	TGGCCA	1 cut(s)	845
BbsI	GAAGAC	1 cut(s)	16
BccI	CCATC	3 cut(s)	220, 634, 774
BceAI	ACGGC	1 cut(s)	78
BciT130I	CCWGG	2 cut(s)	293, 444
BciVI	GTATCC	1 cut(s)	432
BcoDI	GTCTC	3 cut(s)	96, 140, 272
BfaI	CTAG	2 cut(s)	164, 359
BfmI	CTRYAG	2 cut(s)	546, 867
BfuI	GTATCC	1 cut(s)	432
BlpI	GCTNAGC	3 cut(s)	405, 410, 630
BmcAI	AGTACT	1 cut(s)	723
Bme1390I	CCNGG	2 cut(s)	293, 444
Bme18I	GGWCC	1 cut(s)	775
BmgT120I	GGNCC	2 cut(s)	775, 859
BmrFI	CCNGG	2 cut(s)	293, 444
BmsI	GCATC	1 cut(s)	301
BpiI	GAAGAC	1 cut(s)	16
BpmI	CTGGAG	1 cut(s)	164
Bpu10I	CCTNAGC	1 cut(s)	387
Bpu1102I	GCTNAGC	3 cut(s)	405, 410, 630
BsaAI	YACGTR	1 cut(s)	338
BsaI	GGTCTC	2 cut(s)	96, 140
BsaJI	CCNNGG	2 cut(s)	150, 292
BsaWI	WCCGGW	1 cut(s)	94
BsaXI	ACNNNNNCTCC	2 cut(s)	111, 141
Bsc4I	CCNNNNNNNGG	1 cut(s)	772
Bse1I	ACTGG	2 cut(s)	834, 861
Bse21I	CCTNAGG	1 cut(s)	351
Bse3DI	GCAATG	1 cut(s)	265
BseAI	TCCGGA	1 cut(s)	94
BseBI	CCWGG	2 cut(s)	293, 444
BseDI	CCNNGG	2 cut(s)	150, 292
BseGI	GGATG	1 cut(s)	214
BseLI	CCNNNNNNNGG	1 cut(s)	772
BseMI	GCAATG	1 cut(s)	265
BseMII	CTCAG	7 cut(s)	51, 211, 342, 401, 419, 424, 644
BseNI	ACTGG	2 cut(s)	834, 861
BseRI	GAGGAG	2 cut(s)	245, 368
BseYI	CCCAGC	1 cut(s)	615
BshFI	GGCC	2 cut(s)	845, 860
BsiSI	CCGG	1 cut(s)	95
BslI	CCNNNNNNNGG	1 cut(s)	772
BsmAI	GTCTC	3 cut(s)	96, 140, 272
BsnI	GGCC	2 cut(s)	845, 860
Bso31I	GGTCTC	2 cut(s)	96, 140
Bsp13I	TCCGGA	1 cut(s)	94
Bsp1720I	GCTNAGC	3 cut(s)	405, 410, 630
BspACI	CCGC	1 cut(s)	74
BspANI	GGCC	2 cut(s)	845, 860
BspCNI	CTCAG	7 cut(s)	50, 210, 343, 400, 418, 423, 643
BspEI	TCCGGA	1 cut(s)	94
BspHI	TCATGA	1 cut(s)	769
BspMAI	CTGCAG	1 cut(s)	871
BspTNI	GGTCTC	2 cut(s)	96, 140
BsrDI	GCAATG	1 cut(s)	265
BsrI	ACTGG	2 cut(s)	834, 861
BssECI	CCNNGG	2 cut(s)	150, 292
BssT1I	CCWWGG	1 cut(s)	150
Bst2UI	CCWGG	2 cut(s)	293, 444
Bst4CI	ACNGT	3 cut(s)	191, 517, 664
Bst6I	CTCTTC	1 cut(s)	292
BstBAI	YACGTR	1 cut(s)	338
BstC8I	GCNNGC	2 cut(s)	733, 867
BstDEI	CTNAG	7 cut(s)	37, 197, 351, 387, 405, 410, 630
BstF5I	GGATG	1 cut(s)	214
BstMAI	GTCTC	3 cut(s)	96, 140, 272
BstMWI	GCNNNNNNNGC	2 cut(s)	857, 866
BstNI	CCWGG	2 cut(s)	293, 444
BstNSI	RCATGY	1 cut(s)	735
BstSCI	CCNGG	2 cut(s)	291, 442
BstSFI	CTRYAG	2 cut(s)	546, 867
BstV2I	GAAGAC	1 cut(s)	16
Bsu36I	CCTNAGG	1 cut(s)	351
BsuI	GTATCC	1 cut(s)	432
BsuRI	GGCC	2 cut(s)	845, 860
BtsCI	GGATG	1 cut(s)	214
BtsI	GCAGTG	2 cut(s)	504, 846
BtsIMutI	CAGTG	2 cut(s)	504, 846
Cac8I	GCNNGC	2 cut(s)	733, 867
CaiI	CAGNNNCTG	1 cut(s)	287
CciI	TCATGA	1 cut(s)	769
Cfr13I	GGNCC	2 cut(s)	775, 859
CsiI	ACCWGGT	1 cut(s)	442
Csp6I	GTAC	1 cut(s)	722
CviAII	CATG	4 cut(s)	13, 732, 770, 834
CviQI	GTAC	1 cut(s)	722
DdeI	CTNAG	7 cut(s)	37, 197, 351, 387, 405, 410, 630
EaeI	YGGCCR	1 cut(s)	843
Eam1104I	CTCTTC	1 cut(s)	292
EarI	CTCTTC	1 cut(s)	292
Eco130I	CCWWGG	1 cut(s)	150
Eco31I	GGTCTC	2 cut(s)	96, 140
Eco32I	GATATC	1 cut(s)	523
Eco47I	GGWCC	1 cut(s)	775
Eco81I	CCTNAGG	1 cut(s)	351
EcoRII	CCWGG	2 cut(s)	291, 442
EcoRV	GATATC	1 cut(s)	523
EcoT14I	CCWWGG	1 cut(s)	150
EcoT22I	ATGCAT	1 cut(s)	265
ErhI	CCWWGG	1 cut(s)	150
FaeI	CATG	4 cut(s)	16, 735, 773, 837
FatI	CATG	4 cut(s)	12, 731, 769, 833
FokI	GGATG	1 cut(s)	221
FspBI	CTAG	2 cut(s)	164, 359
GsaI	CCCAGC	1 cut(s)	619
GsuI	CTGGAG	1 cut(s)	164
HaeIII	GGCC	2 cut(s)	845, 860
HapII	CCGG	1 cut(s)	95
Hin1II	CATG	4 cut(s)	16, 735, 773, 837
HincII	GTYRAC	2 cut(s)	804, 888
HindII	GTYRAC	2 cut(s)	804, 888
HinfI	GANTC	6 cut(s)	57, 107, 120, 167, 346, 364
HpaII	CCGG	1 cut(s)	95
HphI	GGTGA	1 cut(s)	676
Hpy166II	GTNNAC	5 cut(s)	157, 194, 612, 804, 888
Hpy188I	TCNGA	2 cut(s)	81, 905
Hpy188III	TCNNGA	6 cut(s)	95, 164, 199, 350, 482, 770
Hpy8I	GTNNAC	5 cut(s)	157, 194, 612, 804, 888
Hpy99I	CGWCG	1 cut(s)	89
HpyAV	CCTTC	1 cut(s)	170
HpyCH4III	ACNGT	3 cut(s)	191, 517, 664
HpyCH4IV	ACGT	3 cut(s)	337, 693, 800
HpyCH4V	TGCA	8 cut(s)	104, 263, 319, 509, 735, 755, 818, 869
HpyF10VI	GCNNNNNNNGC	2 cut(s)	857, 866
HpyF3I	CTNAG	7 cut(s)	37, 197, 351, 387, 405, 410, 630
HpySE526I	ACGT	3 cut(s)	337, 693, 800
Hsp92II	CATG	4 cut(s)	16, 735, 773, 837
Kpn2I	TCCGGA	1 cut(s)	94
LmnI	GCTCC	1 cut(s)	355
LweI	GCATC	1 cut(s)	301
MabI	ACCWGGT	1 cut(s)	442
MaeI	CTAG	2 cut(s)	164, 359
MaeII	ACGT	3 cut(s)	337, 693, 800
MaeIII	GTNAC	3 cut(s)	333, 664, 694
MboII	GAAGA	4 cut(s)	16, 309, 355, 463
MlsI	TGGCCA	1 cut(s)	845
MluCI	AATT	6 cut(s)	216, 302, 320, 468, 497, 740
MluNI	TGGCCA	1 cut(s)	845
MlyI	GAGTC	1 cut(s)	114
MmeI	TCCRAC	2 cut(s)	148, 154
MnlI	CCTC	8 cut(s)	19, 91, 223, 277, 346, 597, 646, 766
Mox20I	TGGCCA	1 cut(s)	845
Mph1103I	ATGCAT	1 cut(s)	265
MroI	TCCGGA	1 cut(s)	94
MscI	TGGCCA	1 cut(s)	845
MseI	TTAA	2 cut(s)	393, 882
Msp20I	TGGCCA	1 cut(s)	845
MspI	CCGG	1 cut(s)	95
MspR9I	CCNGG	2 cut(s)	293, 444
MvaI	CCWGG	2 cut(s)	293, 444
MwoI	GCNNNNNNNGC	2 cut(s)	857, 866
NlaIII	CATG	4 cut(s)	16, 735, 773, 837
NmuCI	GTSAC	1 cut(s)	664
NsiI	ATGCAT	1 cut(s)	265
NspI	RCATGY	1 cut(s)	735
PaeI	GCATGC	1 cut(s)	735
PagI	TCATGA	1 cut(s)	769
PfeI	GAWTC	5 cut(s)	57, 107, 167, 346, 364
PleI	GAGTC	1 cut(s)	114
PpsI	GAGTC	1 cut(s)	114
Ppu21I	YACGTR	1 cut(s)	338
Psp6I	CCWGG	2 cut(s)	291, 442
PspFI	CCCAGC	1 cut(s)	615
PspGI	CCWGG	2 cut(s)	291, 442
PspPI	GGNCC	2 cut(s)	775, 859
PstI	CTGCAG	1 cut(s)	871
PstNI	CAGNNNCTG	1 cut(s)	287
RsaI	GTAC	1 cut(s)	723
RsaNI	GTAC	1 cut(s)	722
SaqAI	TTAA	2 cut(s)	393, 882
Sau96I	GGNCC	2 cut(s)	775, 859
ScaI	AGTACT	1 cut(s)	723
SchI	GAGTC	1 cut(s)	114
ScrFI	CCNGG	2 cut(s)	293, 444
SexAI	ACCWGGT	1 cut(s)	442
SfaNI	GCATC	1 cut(s)	301
SfcI	CTRYAG	2 cut(s)	546, 867
SinI	GGWCC	1 cut(s)	775
SphI	GCATGC	1 cut(s)	735
Sse9I	AATT	6 cut(s)	216, 302, 320, 468, 497, 740
SsiI	CCGC	1 cut(s)	74
SspI	AATATT	1 cut(s)	493
SspMI	CTAG	2 cut(s)	164, 359
StyD4I	CCNGG	2 cut(s)	291, 442
StyI	CCWWGG	1 cut(s)	150
TaaI	ACNGT	3 cut(s)	191, 517, 664
TaiI	ACGT	3 cut(s)	340, 696, 803
TaqI	TCGA	1 cut(s)	825
TasI	AATT	6 cut(s)	216, 302, 320, 468, 497, 740
TatI	WGTACW	1 cut(s)	721
TfiI	GAWTC	5 cut(s)	57, 107, 167, 346, 364
Tru1I	TTAA	2 cut(s)	393, 882
Tru9I	TTAA	2 cut(s)	393, 882
TscAI	CASTG	2 cut(s)	511, 853
TseFI	GTSAC	1 cut(s)	664
Tsp45I	GTSAC	1 cut(s)	664
TspDTI	ATGAA	3 cut(s)	225, 395, 733
TspGWI	ACGGA	1 cut(s)	69
TspRI	CASTG	2 cut(s)	511, 853
VpaK11BI	GGWCC	1 cut(s)	775
XapI	RAATTY	2 cut(s)	302, 740
XbaI	TCTAGA	1 cut(s)	163
XceI	RCATGY	1 cut(s)	735
XcmI	CCANNNNNNNNNTGG	1 cut(s)	853
XspI	CTAG	2 cut(s)	164, 359
ZrmI	AGTACT	1 cut(s)	723
Zsp2I	ATGCAT	1 cut(s)	265

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.