Rw4G008080

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
17479486 .. 17480991
1506 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G008080.1

Sequence Viewer

Length: 345 bp
ATGGCAATTCCTCACATTCAGGTAGCTAACAAGTTTACCCAGCCATACATGGCTCAGCTTATGATGGCGATAGATGAGGCTAAAATGGTGACAAGAACCCATTTAGCTAACATGCACGTTACCTTGAAGCCATATACAAAGCAAGTACTCCACGCATGCAGAAAATTCATCAAATCTGCAACTTTTTACCATCATGAGGTCCAAGAAATGCTCAAAAACAATACGTTGACACAATCACTTGCAACTATCGAACTGGCATGGCTTCTGGCCACTGCTTTACTGGCCCTGCCTGCAGTTCTTATGTTTAAGTTGACTTCTGTTATTTTCAGGAAAAAAGGCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

13.02

Weight (kDa)

10.01

Isoelectric Point (pI)

44.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 267
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 3 cut(s) 26, 58, 107
AluI AGCT 3 cut(s) 26, 58, 107
AoxI GGCC 2 cut(s) 267, 282
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 2 cut(s) 199, 283
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 199
BalI TGGCCA 1 cut(s) 269
BccI CCATC 2 cut(s) 58, 198
BfmI CTRYAG 1 cut(s) 291
BlpI GCTNAGC 1 cut(s) 54
BmcAI AGTACT 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 2 cut(s) 199, 283
Bpu1102I GCTNAGC 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 2 cut(s) 258, 285
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 68
BseNI ACTGG 2 cut(s) 258, 285
BseYI CCCAGC 1 cut(s) 39
BshFI GGCC 2 cut(s) 269, 284
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 2 cut(s) 269, 284
Bsp1720I GCTNAGC 1 cut(s) 54
BspANI GGCC 2 cut(s) 269, 284
BspCNI CTCAG 1 cut(s) 67
BspHI TCATGA 1 cut(s) 193
BspMAI CTGCAG 1 cut(s) 295
BsrI ACTGG 2 cut(s) 258, 285
BstC8I GCNNGC 2 cut(s) 157, 291
BstDEI CTNAG 1 cut(s) 54
BstMWI GCNNNNNNNGC 2 cut(s) 281, 290
BstNSI RCATGY 2 cut(s) 115, 159
BstSFI CTRYAG 1 cut(s) 291
BsuRI GGCC 2 cut(s) 269, 284
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cac8I GCNNGC 2 cut(s) 157, 291
CciI TCATGA 1 cut(s) 193
Cfr13I GGNCC 2 cut(s) 199, 283
Csp6I GTAC 1 cut(s) 146
CviAII CATG 5 cut(s) 49, 112, 156, 194, 258
CviQI GTAC 1 cut(s) 146
DdeI CTNAG 1 cut(s) 54
EaeI YGGCCR 1 cut(s) 267
Eco47I GGWCC 1 cut(s) 199
FaeI CATG 5 cut(s) 52, 115, 159, 197, 261
FatI CATG 5 cut(s) 48, 111, 155, 193, 257
GsaI CCCAGC 1 cut(s) 43
HaeIII GGCC 2 cut(s) 269, 284
Hin1II CATG 5 cut(s) 52, 115, 159, 197, 261
HincII GTYRAC 2 cut(s) 228, 312
HindII GTYRAC 2 cut(s) 228, 312
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 3 cut(s) 36, 228, 312
Hpy188III TCNNGA 2 cut(s) 194, 328
Hpy8I GTNNAC 3 cut(s) 36, 228, 312
HpyCH4IV ACGT 2 cut(s) 117, 224
HpyCH4V TGCA 5 cut(s) 115, 159, 179, 242, 293
HpyF10VI GCNNNNNNNGC 2 cut(s) 281, 290
HpyF3I CTNAG 1 cut(s) 54
HpySE526I ACGT 2 cut(s) 117, 224
Hsp92II CATG 5 cut(s) 52, 115, 159, 197, 261
LpnPI CCDG 8 cut(s) 5, 53, 239, 251, 266, 299, 303, 313
MaeII ACGT 2 cut(s) 117, 224
MaeIII GTNAC 2 cut(s) 88, 118
MlsI TGGCCA 1 cut(s) 269
MluCI AATT 2 cut(s) 6, 164
MluNI TGGCCA 1 cut(s) 269
MnlI CCTC 3 cut(s) 21, 70, 190
Mox20I TGGCCA 1 cut(s) 269
MscI TGGCCA 1 cut(s) 269
MseI TTAA 1 cut(s) 306
Msp20I TGGCCA 1 cut(s) 269
MwoI GCNNNNNNNGC 2 cut(s) 281, 290
NlaIII CATG 5 cut(s) 52, 115, 159, 197, 261
NmuCI GTSAC 1 cut(s) 88
NspI RCATGY 2 cut(s) 115, 159
PaeI GCATGC 1 cut(s) 159
PagI TCATGA 1 cut(s) 193
PspFI CCCAGC 1 cut(s) 39
PspPI GGNCC 2 cut(s) 199, 283
PstI CTGCAG 1 cut(s) 295
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 306
Sau96I GGNCC 2 cut(s) 199, 283
ScaI AGTACT 1 cut(s) 147
SetI ASST 8 cut(s) 24, 28, 60, 109, 120, 125, 201, 227
SfcI CTRYAG 1 cut(s) 291
SinI GGWCC 1 cut(s) 199
SphI GCATGC 1 cut(s) 159
Sse9I AATT 2 cut(s) 6, 164
TaiI ACGT 2 cut(s) 120, 227
TaqI TCGA 1 cut(s) 249
TasI AATT 2 cut(s) 6, 164
TatI WGTACW 1 cut(s) 145
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TscAI CASTG 1 cut(s) 277
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 157
TspRI CASTG 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 164
XceI RCATGY 2 cut(s) 115, 159
XcmI CCANNNNNNNNNTGG 1 cut(s) 277
ZrmI AGTACT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.