Rroxscaffold_5G00344870

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
15034638 .. 15036014
1377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00344870.1

Sequence Viewer

Length: 339 bp
ATGGCAAATCCTCACATTCAGGTAGCTAAGAAGTTTACAGAGCCATACATAGCTCACCTTATGATGGTGATAGATGAGGCTACAATGGTGACAAGAACTCATTTAGCTAACATACACATTGCCTTGCAGCCATATACAAAGCAAGTACTCCACGCATGCAGAAAATTCATCAAATCTGCAACTTTTTACCATCATGAGGTCCAAGAAATGCTCAAAAACAATACGTTGACACAATCACTTGCAACTATCGAACTGGCATGGCTTCTGGCCACTGCTTTACTGGCCCTGCCTGCAGTTCTTATGTTTAAGTTGACTTCCGTTATCTTCAGGTTAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.77

Weight (kDa)

9.46

Isoelectric Point (pI)

48.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 267
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 310
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 2 cut(s) 64, 196
AluBI AGCT 3 cut(s) 26, 53, 107
AluI AGCT 3 cut(s) 26, 53, 107
AoxI GGCC 2 cut(s) 267, 282
ApeKI GCWGC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 2 cut(s) 199, 283
AsuHPI GGTGA 3 cut(s) 47, 79, 100
AvaII GGWCC 1 cut(s) 199
BalI TGGCCA 1 cut(s) 269
BbvI GCAGC 1 cut(s) 139
BccI CCATC 2 cut(s) 58, 198
BfmI CTRYAG 1 cut(s) 291
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
BmcAI AGTACT 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 2 cut(s) 199, 283
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 196
Bse1I ACTGG 2 cut(s) 258, 285
Bse3DI GCAATG 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 64, 196
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 2 cut(s) 258, 285
BseXI GCAGC 1 cut(s) 139
BshFI GGCC 2 cut(s) 269, 284
BslI CCNNNNNNNGG 2 cut(s) 64, 196
BsnI GGCC 2 cut(s) 269, 284
BspANI GGCC 2 cut(s) 269, 284
BspHI TCATGA 1 cut(s) 193
BspMAI CTGCAG 1 cut(s) 295
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 2 cut(s) 258, 285
BstC8I GCNNGC 2 cut(s) 157, 291
BstDEI CTNAG 1 cut(s) 27
BstMWI GCNNNNNNNGC 2 cut(s) 281, 290
BstNSI RCATGY 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 291
BstV1I GCAGC 1 cut(s) 139
BsuRI GGCC 2 cut(s) 269, 284
BtsI GCAGTG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 270
Cac8I GCNNGC 2 cut(s) 157, 291
CciI TCATGA 1 cut(s) 193
Cfr13I GGNCC 2 cut(s) 199, 283
Csp6I GTAC 1 cut(s) 146
CviAII CATG 3 cut(s) 156, 194, 258
CviJI RGCY 9 cut(s) 26, 43, 53, 80, 107, 130, 262, 269, 284
CviKI_1 RGCY 9 cut(s) 26, 43, 53, 80, 107, 130, 262, 269, 284
CviQI GTAC 1 cut(s) 146
DdeI CTNAG 1 cut(s) 27
EaeI YGGCCR 1 cut(s) 267
Eco47I GGWCC 1 cut(s) 199
Eco57I CTGAAG 1 cut(s) 310
FaeI CATG 3 cut(s) 159, 197, 261
FatI CATG 3 cut(s) 155, 193, 257
Fnu4HI GCNGC 1 cut(s) 128
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
HaeIII GGCC 2 cut(s) 269, 284
Hin1II CATG 3 cut(s) 159, 197, 261
HincII GTYRAC 2 cut(s) 228, 312
HindII GTYRAC 2 cut(s) 228, 312
HphI GGTGA 3 cut(s) 47, 79, 100
Hpy166II GTNNAC 3 cut(s) 36, 228, 312
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 3 cut(s) 36, 228, 312
HpyCH4IV ACGT 1 cut(s) 224
HpyCH4V TGCA 5 cut(s) 127, 159, 179, 242, 293
HpyF10VI GCNNNNNNNGC 2 cut(s) 281, 290
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 224
Hsp92II CATG 3 cut(s) 159, 197, 261
LpnPI CCDG 7 cut(s) 5, 239, 251, 266, 299, 303, 313
Lsp1109I GCAGC 1 cut(s) 139
MaeII ACGT 1 cut(s) 224
MaeIII GTNAC 1 cut(s) 88
MboII GAAGA 1 cut(s) 316
MlsI TGGCCA 1 cut(s) 269
MluCI AATT 1 cut(s) 164
MluNI TGGCCA 1 cut(s) 269
MnlI CCTC 3 cut(s) 21, 70, 190
Mox20I TGGCCA 1 cut(s) 269
MscI TGGCCA 1 cut(s) 269
MseI TTAA 1 cut(s) 306
Msp20I TGGCCA 1 cut(s) 269
MwoI GCNNNNNNNGC 2 cut(s) 281, 290
NlaIII CATG 3 cut(s) 159, 197, 261
NmuCI GTSAC 1 cut(s) 88
NspI RCATGY 1 cut(s) 159
PaeI GCATGC 1 cut(s) 159
PagI TCATGA 1 cut(s) 193
PkrI GCNGC 1 cut(s) 129
PspPI GGNCC 2 cut(s) 199, 283
PstI CTGCAG 1 cut(s) 295
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 306
SatI GCNGC 1 cut(s) 128
Sau96I GGNCC 2 cut(s) 199, 283
ScaI AGTACT 1 cut(s) 147
SetI ASST 8 cut(s) 24, 28, 55, 60, 109, 201, 227, 332
SfcI CTRYAG 1 cut(s) 291
SinI GGWCC 1 cut(s) 199
SphI GCATGC 1 cut(s) 159
Sse9I AATT 1 cut(s) 164
TaiI ACGT 1 cut(s) 227
TaqI TCGA 1 cut(s) 249
TasI AATT 1 cut(s) 164
TatI WGTACW 1 cut(s) 145
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TscAI CASTG 1 cut(s) 277
TseFI GTSAC 1 cut(s) 88
TseI GCWGC 1 cut(s) 127
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 157
TspGWI ACGGA 1 cut(s) 307
TspRI CASTG 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 164
XceI RCATGY 1 cut(s) 159
XcmI CCANNNNNNNNNTGG 1 cut(s) 277
ZrmI AGTACT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.