RLG00000021567

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
OG0015772
Physical Location & Seq
Reverse (-)
76435574 .. 76435879
306 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000021567

Sequence Viewer

Length: 306 bp
ATGGCAGATGAGCTTGACAAGTATGATGAGGATTTAGATCACCCTTCTTTCATGAACTGGTGGATTGATGATGTAGAATCCATTAGTTATGATGGGGATGATGATGGGCCTCCAATTGTAAAGCTATCAGATGATGATGGGCCATTTATAGATGAAACTACAGAAGATAATGTTGTTCCAGGTAACCTTGATGGGTTGGGGGTTGGTACTGGGCCAAGGGTTGGTAATGGGCCAAGGTCAGATGATGGGCCAGGAAACATAGACTGGCAGGCCTTGAGAGCCAATCAAGGGAAAAAAGAACTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.02

Weight (kDa)

4.05

Isoelectric Point (pI)

26.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 221
AfaI GTAC 1 cut(s) 208
AfiI CCNNNNNNNGG 2 cut(s) 221, 288
AjnI CCWGG 2 cut(s) 178, 250
AluBI AGCT 2 cut(s) 13, 124
AluI AGCT 2 cut(s) 13, 124
AoxI GGCC 6 cut(s) 107, 140, 212, 230, 248, 270
AspS9I GGNCC 5 cut(s) 107, 140, 212, 230, 248
AsuHPI GGTGA 1 cut(s) 32
BccI CCATC 5 cut(s) 86, 98, 131, 185, 239
BciT130I CCWGG 2 cut(s) 180, 252
BfmI CTRYAG 1 cut(s) 159
Bme1390I CCNGG 2 cut(s) 180, 252
BmgT120I GGNCC 5 cut(s) 107, 140, 212, 230, 248
BmrFI CCNGG 2 cut(s) 180, 252
BmrI ACTGGG 1 cut(s) 219
BmuI ACTGGG 1 cut(s) 219
BpuEI CTTGAG 1 cut(s) 295
BsaBI GATNNNNATC 1 cut(s) 36
BsaJI CCNNGG 2 cut(s) 215, 233
Bsc4I CCNNNNNNNGG 2 cut(s) 221, 288
Bse1I ACTGG 3 cut(s) 62, 214, 269
Bse8I GATNNNNATC 1 cut(s) 36
BseBI CCWGG 2 cut(s) 180, 252
BseDI CCNNGG 2 cut(s) 215, 233
BseGI GGATG 1 cut(s) 103
BseJI GATNNNNATC 1 cut(s) 36
BseLI CCNNNNNNNGG 2 cut(s) 221, 288
BseNI ACTGG 3 cut(s) 62, 214, 269
BshFI GGCC 6 cut(s) 109, 142, 214, 232, 250, 272
BslI CCNNNNNNNGG 2 cut(s) 221, 288
BsnI GGCC 6 cut(s) 109, 142, 214, 232, 250, 272
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 6 cut(s) 109, 142, 214, 232, 250, 272
BspHI TCATGA 1 cut(s) 51
BsrI ACTGG 3 cut(s) 62, 214, 269
BssECI CCNNGG 2 cut(s) 215, 233
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 2 cut(s) 215, 233
Bst2UI CCWGG 2 cut(s) 180, 252
BstC8I GCNNGC 1 cut(s) 270
BstEII GGTNACC 1 cut(s) 182
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 278
BstNI CCWGG 2 cut(s) 180, 252
BstPI GGTNACC 1 cut(s) 182
BstSCI CCNGG 2 cut(s) 178, 250
BstSFI CTRYAG 1 cut(s) 159
BsuRI GGCC 6 cut(s) 109, 142, 214, 232, 250, 272
BtsCI GGATG 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 270
CciI TCATGA 1 cut(s) 51
Cfr13I GGNCC 5 cut(s) 107, 140, 212, 230, 248
Csp6I GTAC 1 cut(s) 207
CviAII CATG 1 cut(s) 52
CviJI RGCY 9 cut(s) 13, 109, 124, 142, 214, 232, 250, 272, 281
CviKI_1 RGCY 9 cut(s) 13, 109, 124, 142, 214, 232, 250, 272, 281
CviQI GTAC 1 cut(s) 207
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eco130I CCWWGG 2 cut(s) 215, 233
Eco147I AGGCCT 1 cut(s) 272
Eco91I GGTNACC 1 cut(s) 182
EcoO65I GGTNACC 1 cut(s) 182
EcoRII CCWGG 2 cut(s) 178, 250
EcoT14I CCWWGG 2 cut(s) 215, 233
ErhI CCWWGG 2 cut(s) 215, 233
FaeI CATG 1 cut(s) 55
FaiI YATR 5 cut(s) 24, 53, 90, 149, 260
FatI CATG 1 cut(s) 51
FokI GGATG 1 cut(s) 110
HaeIII GGCC 6 cut(s) 109, 142, 214, 232, 250, 272
Hin1II CATG 1 cut(s) 55
HinfI GANTC 1 cut(s) 77
HphI GGTGA 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 130, 241
Hpy188III TCNNGA 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 278
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 8 cut(s) 43, 165, 192, 195, 237, 250, 254, 264
MaeIII GTNAC 1 cut(s) 182
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 176
MfeI CAATTG 1 cut(s) 114
MluCI AATT 1 cut(s) 114
MnlI CCTC 2 cut(s) 22, 120
MspR9I CCNGG 2 cut(s) 180, 252
MunI CAATTG 1 cut(s) 114
MvaI CCWGG 2 cut(s) 180, 252
MwoI GCNNNNNNNGC 1 cut(s) 278
NdeII GATC 1 cut(s) 37
NlaIII CATG 1 cut(s) 55
PagI TCATGA 1 cut(s) 51
PceI AGGCCT 1 cut(s) 272
PfeI GAWTC 1 cut(s) 77
PflMI CCANNNNNTGG 1 cut(s) 221
Psp6I CCWGG 2 cut(s) 178, 250
PspEI GGTNACC 1 cut(s) 182
PspGI CCWGG 2 cut(s) 178, 250
PspPI GGNCC 5 cut(s) 107, 140, 212, 230, 248
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 5 cut(s) 107, 140, 212, 230, 248
ScrFI CCNGG 2 cut(s) 180, 252
SetI ASST 5 cut(s) 15, 126, 184, 189, 239
SfcI CTRYAG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 274
SmoI CTYRAG 1 cut(s) 274
Sse9I AATT 1 cut(s) 114
SseBI AGGCCT 1 cut(s) 272
StuI AGGCCT 1 cut(s) 272
StyD4I CCNGG 2 cut(s) 178, 250
StyI CCWWGG 2 cut(s) 215, 233
TasI AATT 1 cut(s) 114
TfiI GAWTC 1 cut(s) 77
TspDTI ATGAA 3 cut(s) 40, 68, 168
Van91I CCANNNNNTGG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.