Rh6BG378200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
60708247 .. 60708561
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG378200.1

Sequence Viewer

Length: 315 bp
ATGAACTGGTGGATTAATGATGTAGAAGAATTGTCCATTAGTGAAGATGAGGATGATGAAGGGCCTCCAGTTGTGGACCTGTCAGGTGATGAAGGGCCAGTCGAAGAGCACACTGCAGAGGATGATGATGTTCCAGGTAAGGATGATGGCCCAATGTTTGATGATGGGCTAGGGAATGTGGATAGCCAGGTAAGGATGATGGGCCAAACAACCATAATTAATGGCCCAAGGTCTGATGATGGGCCAGGGAATGTTGATGGGCCAGGCTGTGAGAAACAATCAAGGAATAGAAGAACTTTAGACAAAGGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.3

Weight (kDa)

4.05

Isoelectric Point (pI)

39.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 4 cut(s) 133, 186, 244, 262
Alw21I GWGCWC 1 cut(s) 111
AoxI GGCC 7 cut(s) 62, 95, 148, 202, 223, 242, 260
AseI ATTAAT 2 cut(s) 15, 219
AspS9I GGNCC 8 cut(s) 62, 76, 95, 149, 202, 224, 242, 260
AsuHPI GGTGA 1 cut(s) 98
AvaII GGWCC 1 cut(s) 76
Bbv12I GWGCWC 1 cut(s) 111
BccI CCATC 5 cut(s) 140, 158, 193, 233, 251
BciT130I CCWGG 4 cut(s) 135, 188, 246, 264
BfaI CTAG 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 114
Bme1390I CCNGG 4 cut(s) 135, 188, 246, 264
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 8 cut(s) 62, 76, 95, 149, 202, 224, 242, 260
BmrFI CCNGG 4 cut(s) 135, 188, 246, 264
BpmI CTGGAG 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 227, 245
Bse1I ACTGG 3 cut(s) 11, 68, 98
BseBI CCWGG 4 cut(s) 135, 188, 246, 264
BseDI CCNNGG 2 cut(s) 227, 245
BseGI GGATG 4 cut(s) 58, 127, 148, 201
BseNI ACTGG 3 cut(s) 11, 68, 98
BshFI GGCC 7 cut(s) 64, 97, 150, 204, 225, 244, 262
BsiHKAI GWGCWC 1 cut(s) 111
BsnI GGCC 7 cut(s) 64, 97, 150, 204, 225, 244, 262
Bsp1286I GDGCHC 1 cut(s) 111
BspANI GGCC 7 cut(s) 64, 97, 150, 204, 225, 244, 262
BspMAI CTGCAG 1 cut(s) 118
BspQI GCTCTTC 1 cut(s) 99
BsrI ACTGG 3 cut(s) 11, 68, 98
BssECI CCNNGG 2 cut(s) 227, 245
BssT1I CCWWGG 1 cut(s) 227
Bst2UI CCWGG 4 cut(s) 135, 188, 246, 264
Bst6I CTCTTC 1 cut(s) 99
BstF5I GGATG 4 cut(s) 58, 127, 148, 201
BstNI CCWGG 4 cut(s) 135, 188, 246, 264
BstSCI CCNGG 4 cut(s) 133, 186, 244, 262
BstSFI CTRYAG 1 cut(s) 114
BsuRI GGCC 7 cut(s) 64, 97, 150, 204, 225, 244, 262
BtsCI GGATG 4 cut(s) 58, 127, 148, 201
BtsI GCAGTG 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 111
Cfr13I GGNCC 8 cut(s) 62, 76, 95, 149, 202, 224, 242, 260
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco130I CCWWGG 1 cut(s) 227
Eco47I GGWCC 1 cut(s) 76
EcoO109I RGGNCCY 1 cut(s) 62
EcoRII CCWGG 4 cut(s) 133, 186, 244, 262
EcoT14I CCWWGG 1 cut(s) 227
ErhI CCWWGG 1 cut(s) 227
FaiI YATR 1 cut(s) 215
FokI GGATG 4 cut(s) 65, 134, 155, 208
FspBI CTAG 1 cut(s) 170
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 7 cut(s) 64, 97, 150, 204, 225, 244, 262
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 235
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 2 cut(s) 53, 86
HpyCH4V TGCA 1 cut(s) 116
LguI GCTCTTC 1 cut(s) 99
MaeI CTAG 1 cut(s) 170
MboII GAAGA 4 cut(s) 38, 56, 116, 303
MhlI GDGCHC 1 cut(s) 111
MluCI AATT 2 cut(s) 29, 216
MnlI CCTC 3 cut(s) 43, 75, 112
MseI TTAA 2 cut(s) 15, 219
MspR9I CCNGG 4 cut(s) 135, 188, 246, 264
MvaI CCWGG 4 cut(s) 135, 188, 246, 264
PciSI GCTCTTC 1 cut(s) 99
PshBI ATTAAT 2 cut(s) 15, 219
Psp6I CCWGG 4 cut(s) 133, 186, 244, 262
PspGI CCWGG 4 cut(s) 133, 186, 244, 262
PspPI GGNCC 8 cut(s) 62, 76, 95, 149, 202, 224, 242, 260
PstI CTGCAG 1 cut(s) 118
SapI GCTCTTC 1 cut(s) 99
SaqAI TTAA 2 cut(s) 15, 219
Sau96I GGNCC 8 cut(s) 62, 76, 95, 149, 202, 224, 242, 260
ScrFI CCNGG 4 cut(s) 135, 188, 246, 264
SduI GDGCHC 1 cut(s) 111
SetI ASST 5 cut(s) 81, 88, 139, 192, 233
SfcI CTRYAG 1 cut(s) 114
SinI GGWCC 1 cut(s) 76
Sse9I AATT 2 cut(s) 29, 216
SspMI CTAG 1 cut(s) 170
StyD4I CCNGG 4 cut(s) 133, 186, 244, 262
StyI CCWWGG 1 cut(s) 227
TaqI TCGA 1 cut(s) 102
TasI AATT 2 cut(s) 29, 216
Tru1I TTAA 2 cut(s) 15, 219
Tru9I TTAA 2 cut(s) 15, 219
TscAI CASTG 1 cut(s) 118
TspDTI ATGAA 3 cut(s) 17, 72, 105
TspRI CASTG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 76
VspI ATTAAT 2 cut(s) 15, 219
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.