Rh6CG383800

receptor-like protein 12

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0015772
Physical Location & Seq
Forward (+)
57058837 .. 57059160
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG383800.1

Sequence Viewer

Length: 324 bp
ATGAGGGTATTCAGTGTAGAAGAGCTGAAGAAGTATGATGAGGATTTAGATCACACCTCTTTCATGAACTGGTGGATTGATGATGTAGAAGAAGGGTCCATTAGTGAAGATGAGGATGATGAAGGGCCTCCAGTTGTGGACCTGTCAAATGATGAAGGGCCAGTCGAAGAGCACACTACAGAGGACAATGATGTTCCAGGTAAGGATGATGGCCCAGTGTTTGATGATGGGCTAGGGAATGTGGATAGCCAGGTAAGGATGATGGGCCAAACAACCATAATGGCCAAAGGTCTGATGATGGGTCAGGGACTGTTGATGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0048507 GO:0048856
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_1 LRR_8

Protein Analysis

107

Amino Acids

11.88

Weight (kDa)

4.05

Isoelectric Point (pI)

35.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 282
AcuI CTGAAG 1 cut(s) 47
AjnI CCWGG 2 cut(s) 196, 249
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
Alw21I GWGCWC 1 cut(s) 174
AlwNI CAGNNNCTG 1 cut(s) 310
AoxI GGCC 5 cut(s) 125, 158, 211, 265, 282
AspS9I GGNCC 6 cut(s) 96, 125, 139, 158, 212, 265
AvaII GGWCC 2 cut(s) 96, 139
BalI TGGCCA 1 cut(s) 284
Bbv12I GWGCWC 1 cut(s) 174
BccI CCATC 5 cut(s) 203, 221, 256, 292, 310
BciT130I CCWGG 2 cut(s) 198, 251
BfaI CTAG 2 cut(s) 233, 322
BfmI CTRYAG 1 cut(s) 177
Bme1390I CCNGG 2 cut(s) 198, 251
Bme18I GGWCC 2 cut(s) 96, 139
BmgT120I GGNCC 6 cut(s) 96, 125, 139, 158, 212, 265
BmiI GGNNCC 1 cut(s) 97
BmrFI CCNGG 2 cut(s) 198, 251
BmrI ACTGGG 1 cut(s) 209
BmuI ACTGGG 1 cut(s) 209
BpmI CTGGAG 1 cut(s) 114
BsaBI GATNNNNATC 1 cut(s) 48
Bse1I ACTGG 4 cut(s) 74, 131, 161, 215
Bse8I GATNNNNATC 1 cut(s) 48
BseBI CCWGG 2 cut(s) 198, 251
BseGI GGATG 3 cut(s) 121, 211, 264
BseJI GATNNNNATC 1 cut(s) 48
BseNI ACTGG 4 cut(s) 74, 131, 161, 215
BshFI GGCC 5 cut(s) 127, 160, 213, 267, 284
BsiHKAI GWGCWC 1 cut(s) 174
BsnI GGCC 5 cut(s) 127, 160, 213, 267, 284
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 49
BspANI GGCC 5 cut(s) 127, 160, 213, 267, 284
BspHI TCATGA 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 97
BspQI GCTCTTC 2 cut(s) 15, 162
BsrI ACTGG 4 cut(s) 74, 131, 161, 215
BssMI GATC 1 cut(s) 49
Bst2UI CCWGG 2 cut(s) 198, 251
Bst4CI ACNGT 1 cut(s) 312
Bst6I CTCTTC 2 cut(s) 15, 162
BstF5I GGATG 3 cut(s) 121, 211, 264
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstNI CCWGG 2 cut(s) 198, 251
BstSCI CCNGG 2 cut(s) 196, 249
BstSFI CTRYAG 1 cut(s) 177
BsuRI GGCC 5 cut(s) 127, 160, 213, 267, 284
BtsCI GGATG 3 cut(s) 121, 211, 264
BtsIMutI CAGTG 2 cut(s) 19, 222
CaiI CAGNNNCTG 1 cut(s) 310
CciI TCATGA 1 cut(s) 63
Cfr13I GGNCC 6 cut(s) 96, 125, 139, 158, 212, 265
CviAII CATG 1 cut(s) 64
CviJI RGCY 9 cut(s) 25, 127, 160, 213, 232, 249, 267, 284, 321
CviKI_1 RGCY 9 cut(s) 25, 127, 160, 213, 232, 249, 267, 284, 321
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
EaeI YGGCCR 1 cut(s) 282
Eam1104I CTCTTC 2 cut(s) 15, 162
EarI CTCTTC 2 cut(s) 15, 162
Eco47I GGWCC 2 cut(s) 96, 139
Eco57I CTGAAG 1 cut(s) 47
EcoO109I RGGNCCY 1 cut(s) 125
EcoRII CCWGG 2 cut(s) 196, 249
FaeI CATG 1 cut(s) 67
FaiI YATR 3 cut(s) 36, 65, 278
FatI CATG 1 cut(s) 63
FokI GGATG 3 cut(s) 128, 218, 271
FspBI CTAG 2 cut(s) 233, 322
GsuI CTGGAG 1 cut(s) 114
HaeIII GGCC 5 cut(s) 127, 160, 213, 267, 284
Hin1II CATG 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 294
Hpy188III TCNNGA 1 cut(s) 64
Hpy8I GTNNAC 1 cut(s) 139
HpyAV CCTTC 3 cut(s) 86, 116, 149
HpyCH4III ACNGT 1 cut(s) 312
Hsp92II CATG 1 cut(s) 67
Kzo9I GATC 1 cut(s) 49
LguI GCTCTTC 2 cut(s) 15, 162
MaeI CTAG 2 cut(s) 233, 322
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 5 cut(s) 32, 40, 101, 119, 179
MhlI GDGCHC 1 cut(s) 174
MlsI TGGCCA 1 cut(s) 284
MluNI TGGCCA 1 cut(s) 284
MnlI CCTC 5 cut(s) 34, 67, 106, 138, 175
Mox20I TGGCCA 1 cut(s) 284
MscI TGGCCA 1 cut(s) 284
Msp20I TGGCCA 1 cut(s) 284
MspR9I CCNGG 2 cut(s) 198, 251
MvaI CCWGG 2 cut(s) 198, 251
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 67
NlaIV GGNNCC 1 cut(s) 97
PagI TCATGA 1 cut(s) 63
PciSI GCTCTTC 2 cut(s) 15, 162
Psp6I CCWGG 2 cut(s) 196, 249
PspGI CCWGG 2 cut(s) 196, 249
PspN4I GGNNCC 1 cut(s) 97
PspPI GGNCC 6 cut(s) 96, 125, 139, 158, 212, 265
PstNI CAGNNNCTG 1 cut(s) 310
SapI GCTCTTC 2 cut(s) 15, 162
Sau3AI GATC 1 cut(s) 49
Sau96I GGNCC 6 cut(s) 96, 125, 139, 158, 212, 265
ScrFI CCNGG 2 cut(s) 198, 251
SduI GDGCHC 1 cut(s) 174
SetI ASST 6 cut(s) 27, 59, 144, 202, 255, 292
SfcI CTRYAG 1 cut(s) 177
SinI GGWCC 2 cut(s) 96, 139
SspMI CTAG 2 cut(s) 233, 322
StyD4I CCNGG 2 cut(s) 196, 249
TaaI ACNGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 165
TscAI CASTG 2 cut(s) 19, 222
TspDTI ATGAA 4 cut(s) 52, 80, 135, 168
TspRI CASTG 2 cut(s) 19, 222
VpaK11BI GGWCC 2 cut(s) 96, 139
XspI CTAG 2 cut(s) 233, 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.