RLG00000030167

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
56720961 .. 56721941
981 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030167

Sequence Viewer

Length: 360 bp
ATGTTGGAATTGAGGTGGTTGAGGAGGTTAAATGTAGGTTTAGGGTTTATGGCTAGGTCCATTAGTGAAGATGAAGATGATGAAGGGCATCTAGTTGTGGACCTATCAGATGATGAAGGGCCAGTTGATGTGGATGGGCCAGGTAATGATGATGGGCCAAACAACCATAATGGCCCAAGGGACGATGATGGGCCAAGGAATGTGGATGGGCCAGGTTGTGAGAGCCAATCAAGGAAAAAAAGAACTTTAGATAAAGGAAAACAGAAGGTGCAAGGTGAAGACATTCCTGCTCCAAAGAAAAAGAAAGGCAGACCAAAGAAGGTTGTTCAACCTAGCTATGCAACCAGGTCTGGGGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.0

Weight (kDa)

5.7

Isoelectric Point (pI)

53.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 351
AgsI TTSAA 1 cut(s) 329
AjnI CCWGG 3 cut(s) 139, 211, 344
AluBI AGCT 1 cut(s) 336
AluI AGCT 1 cut(s) 336
AoxI GGCC 6 cut(s) 119, 137, 155, 172, 191, 209
Asp700I GAANNNNTTC 1 cut(s) 282
AspS9I GGNCC 8 cut(s) 57, 100, 119, 137, 155, 173, 191, 209
AsuHPI GGTGA 1 cut(s) 287
AvaII GGWCC 2 cut(s) 57, 100
BbsI GAAGAC 1 cut(s) 285
BccI CCATC 4 cut(s) 128, 146, 182, 200
BciT130I CCWGG 3 cut(s) 141, 213, 346
BfaI CTAG 3 cut(s) 54, 92, 333
Bme1390I CCNGG 3 cut(s) 141, 213, 346
Bme18I GGWCC 2 cut(s) 57, 100
BmgT120I GGNCC 8 cut(s) 57, 100, 119, 137, 155, 173, 191, 209
BmrFI CCNGG 3 cut(s) 141, 213, 346
BmsI GCATC 1 cut(s) 97
BpiI GAAGAC 1 cut(s) 285
BsaJI CCNNGG 2 cut(s) 176, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 351
Bse1I ACTGG 1 cut(s) 122
BseBI CCWGG 3 cut(s) 141, 213, 346
BseDI CCNNGG 2 cut(s) 176, 194
BseGI GGATG 2 cut(s) 139, 211
BseLI CCNNNNNNNGG 1 cut(s) 351
BseNI ACTGG 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 37
BshFI GGCC 6 cut(s) 121, 139, 157, 174, 193, 211
BslFI GGGAC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 351
BsmFI GGGAC 1 cut(s) 194
BsnI GGCC 6 cut(s) 121, 139, 157, 174, 193, 211
BspANI GGCC 6 cut(s) 121, 139, 157, 174, 193, 211
BsrI ACTGG 1 cut(s) 122
BssECI CCNNGG 2 cut(s) 176, 194
BssT1I CCWWGG 2 cut(s) 176, 194
Bst2UI CCWGG 3 cut(s) 141, 213, 346
BstF5I GGATG 2 cut(s) 139, 211
BstNI CCWGG 3 cut(s) 141, 213, 346
BstSCI CCNGG 3 cut(s) 139, 211, 344
BstV2I GAAGAC 1 cut(s) 285
BsuRI GGCC 6 cut(s) 121, 139, 157, 174, 193, 211
BtsCI GGATG 2 cut(s) 139, 211
Cfr13I GGNCC 8 cut(s) 57, 100, 119, 137, 155, 173, 191, 209
CsiI ACCWGGT 1 cut(s) 344
CspCI CAANNNNNGTGG 2 cut(s) 183, 218
CviJI RGCY 9 cut(s) 53, 121, 139, 157, 174, 193, 211, 225, 336
CviKI_1 RGCY 9 cut(s) 53, 121, 139, 157, 174, 193, 211, 225, 336
Eco130I CCWWGG 2 cut(s) 176, 194
Eco47I GGWCC 2 cut(s) 57, 100
EcoRII CCWGG 3 cut(s) 139, 211, 344
EcoT14I CCWWGG 2 cut(s) 176, 194
ErhI CCWWGG 2 cut(s) 176, 194
FaiI YATR 3 cut(s) 50, 168, 339
FaqI GGGAC 1 cut(s) 194
FokI GGATG 2 cut(s) 146, 218
FspBI CTAG 3 cut(s) 54, 92, 333
HaeIII GGCC 6 cut(s) 121, 139, 157, 174, 193, 211
HphI GGTGA 1 cut(s) 287
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 4 cut(s) 77, 110, 259, 313
HpyCH4V TGCA 2 cut(s) 271, 341
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 8 cut(s) 126, 135, 153, 198, 225, 300, 331, 336
LweI GCATC 1 cut(s) 97
MabI ACCWGGT 1 cut(s) 344
MaeI CTAG 3 cut(s) 54, 92, 333
MboII GAAGA 3 cut(s) 80, 86, 290
MluCI AATT 1 cut(s) 8
MnlI CCTC 3 cut(s) 6, 15, 18
MroXI GAANNNNTTC 1 cut(s) 282
MseI TTAA 1 cut(s) 29
MspR9I CCNGG 3 cut(s) 141, 213, 346
MvaI CCWGG 3 cut(s) 141, 213, 346
PdmI GAANNNNTTC 1 cut(s) 282
Psp6I CCWGG 3 cut(s) 139, 211, 344
PspGI CCWGG 3 cut(s) 139, 211, 344
PspPI GGNCC 8 cut(s) 57, 100, 119, 137, 155, 173, 191, 209
SaqAI TTAA 1 cut(s) 29
Sau96I GGNCC 8 cut(s) 57, 100, 119, 137, 155, 173, 191, 209
ScrFI CCNGG 3 cut(s) 141, 213, 346
SexAI ACCWGGT 1 cut(s) 344
SfaNI GCATC 1 cut(s) 97
SinI GGWCC 2 cut(s) 57, 100
Sse9I AATT 1 cut(s) 8
SspMI CTAG 3 cut(s) 54, 92, 333
StyD4I CCNGG 3 cut(s) 139, 211, 344
StyI CCWWGG 2 cut(s) 176, 194
TasI AATT 1 cut(s) 8
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TspDTI ATGAA 3 cut(s) 87, 96, 129
VpaK11BI GGWCC 2 cut(s) 57, 100
XmnI GAANNNNTTC 1 cut(s) 282
XspI CTAG 3 cut(s) 54, 92, 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.