Rmu_co7962372.1_g000001

GPI ethanolamine phosphate transferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7962372.1
OG0002335
Physical Location & Seq
Reverse (-)
1 .. 475
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7962372.1_g000001.1.cds

Sequence Viewer

Length: 193 bp
atggcggtgttgatgagatgtaggagttgttttgcagggtggaaagctaatcctgttgaattcgattcggtgtttaatcggagccggcatacattttcctatggtagtccggatatagttccgattttctgtgctgcattgcctcacactacttggaacagttatcctcatgattttgaagactttgctactg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00563 ko01100 map00563 map01100
Pfam Domains
Protein Families
Phosphodiest PigN Sulfatase

Protein Analysis

64

Amino Acids

7.35

Weight (kDa)

6.23

Isoelectric Point (pI)

55.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 109
AciI CCGC 1 cut(s) 5
AcsI RAATTY 1 cut(s) 59
AgsI TTSAA 2 cut(s) 59, 179
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
Aor13HI TCCGGA 1 cut(s) 109
ApeKI GCWGC 1 cut(s) 134
ApoI RAATTY 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 121
BisI GCNGC 1 cut(s) 135
BlsI GCNGC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 83
BpiI GAAGAC 1 cut(s) 186
BsaWI WCCGGW 1 cut(s) 109
Bse118I RCCGGY 1 cut(s) 84
Bse3DI GCAATG 1 cut(s) 137
BseAI TCCGGA 1 cut(s) 109
BseMI GCAATG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 121
BsiSI CCGG 2 cut(s) 85, 110
Bsp13I TCCGGA 1 cut(s) 109
BspACI CCGC 1 cut(s) 5
BspEI TCCGGA 1 cut(s) 109
BspHI TCATGA 1 cut(s) 169
BspLI GGNNCC 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 137
BsrFI RCCGGY 1 cut(s) 84
BssAI RCCGGY 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 161
BstC8I GCNNGC 1 cut(s) 86
BstV1I GCAGC 1 cut(s) 121
BstV2I GAAGAC 1 cut(s) 186
Cac8I GCNNGC 1 cut(s) 86
CciI TCATGA 1 cut(s) 169
Cfr10I RCCGGY 1 cut(s) 84
CviAII CATG 1 cut(s) 170
CviJI RGCY 2 cut(s) 47, 84
CviKI_1 RGCY 2 cut(s) 47, 84
EcoRI GAATTC 1 cut(s) 59
FaeI CATG 1 cut(s) 173
FaiI YATR 4 cut(s) 90, 102, 116, 171
FatI CATG 1 cut(s) 169
Fnu4HI GCNGC 1 cut(s) 135
Fsp4HI GCNGC 1 cut(s) 135
GluI GCNGC 1 cut(s) 135
HapII CCGG 2 cut(s) 85, 110
Hin1II CATG 1 cut(s) 173
HinfI GANTC 1 cut(s) 65
HpaII CCGG 2 cut(s) 85, 110
Hpy188I TCNGA 2 cut(s) 81, 123
Hpy188III TCNNGA 2 cut(s) 110, 170
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4V TGCA 2 cut(s) 35, 137
Hsp92II CATG 1 cut(s) 173
Kpn2I TCCGGA 1 cut(s) 109
KroI GCCGGC 1 cut(s) 84
KroNI GCCGGC 1 cut(s) 86
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 4 cut(s) 21, 66, 98, 123
Lsp1109I GCAGC 1 cut(s) 121
MboII GAAGA 1 cut(s) 191
MluCI AATT 1 cut(s) 59
MnlI CCTC 2 cut(s) 153, 177
MroI TCCGGA 1 cut(s) 109
MroNI GCCGGC 1 cut(s) 84
MseI TTAA 1 cut(s) 75
MspI CCGG 2 cut(s) 85, 110
NaeI GCCGGC 1 cut(s) 86
NgoMIV GCCGGC 1 cut(s) 84
NlaIII CATG 1 cut(s) 173
NlaIV GGNNCC 1 cut(s) 83
PagI TCATGA 1 cut(s) 169
PdiI GCCGGC 1 cut(s) 86
PfeI GAWTC 1 cut(s) 65
PkrI GCNGC 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 83
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 135
SetI ASST 1 cut(s) 49
SgeI CNNG 6 cut(s) 48, 65, 97, 122, 165, 182
Sse9I AATT 1 cut(s) 59
SsiI CCGC 1 cut(s) 5
TaaI ACNGT 1 cut(s) 161
TaqI TCGA 1 cut(s) 63
TasI AATT 1 cut(s) 59
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseI GCWGC 1 cut(s) 134
XapI RAATTY 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.