Rroxscaffold_2G00081270

GPI ethanolamine phosphate transferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002335
Physical Location & Seq
Forward (+)
4275881 .. 4279183
3303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00081270.1

Sequence Viewer

Length: 378 bp
ATGTCTGCAGAATTTGGAGCGGGGGTTATGATTATTATGATCGGGGTAGCTGGTAGGTTTCTAGATCAACATACTGAAGGAAACAAGTTTTGGCTCAGTATCTGTAATAGTGATGCAAAGAAACCCAAGTTCCCCATGCTCTTTCAGTTACAGGCTCTTTTGGTTGGATTATCATCTGTGATGGTGTCAATATCAACATCTCATAGAACAGAGAACCAAGAACTGCATGTCTGGCACCAGATTATAAATTGGTCCATTGCTGGTGCTTCATCAGAAAGTGCTTATATAAGAAGTCTTCAGAATTTGAGTAAAGAATATTGTTTTGGGACAAAAGTGGTTCCAGCAAACATAAACAAACGTGGTAGTCACGAACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00563 ko01100 map00563 map01100
Pfam Domains
Protein Families
Phosphodiest PigN Sulfatase

Protein Analysis

125

Amino Acids

13.9

Weight (kDa)

8.67

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PigN PF04987 7 - 96 2.3e-07 Phosphatidylinositolglycan class N (PIG-N)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 245
AccB1I GGYRCC 1 cut(s) 234
AccBSI CCGCTC 1 cut(s) 20
AciI CCGC 1 cut(s) 20
AcsI RAATTY 2 cut(s) 11, 301
AcuI CTGAAG 2 cut(s) 96, 281
AjuI GAANNNNNNNTTGG 4 cut(s) 73, 105, 306, 338
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AlwNI CAGNNNCTG 1 cut(s) 102
ApoI RAATTY 2 cut(s) 11, 301
AspS9I GGNCC 1 cut(s) 252
AvaII GGWCC 1 cut(s) 252
BanI GGYRCC 1 cut(s) 234
BbsI GAAGAC 1 cut(s) 287
BccI CCATC 1 cut(s) 175
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 6
Bme18I GGWCC 1 cut(s) 252
BmgT120I GGNCC 1 cut(s) 252
BmiI GGNNCC 2 cut(s) 236, 339
BmsI GCATC 1 cut(s) 103
BpiI GAAGAC 1 cut(s) 287
BsaBI GATNNNNATC 1 cut(s) 172
BsaXI ACNNNNNCTCC 2 cut(s) 9, 39
Bse3DI GCAATG 1 cut(s) 255
Bse8I GATNNNNATC 1 cut(s) 172
BseJI GATNNNNATC 1 cut(s) 172
BseMI GCAATG 1 cut(s) 255
BseMII CTCAG 1 cut(s) 109
BshNI GGYRCC 1 cut(s) 234
BslFI GGGAC 1 cut(s) 340
BsmFI GGGAC 1 cut(s) 340
Bsp143I GATC 2 cut(s) 39, 64
BspACI CCGC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 108
BspLI GGNNCC 2 cut(s) 236, 339
BspMAI CTGCAG 1 cut(s) 10
BspT107I GGYRCC 1 cut(s) 234
BsrBI CCGCTC 1 cut(s) 20
BsrDI GCAATG 1 cut(s) 255
BssMI GATC 2 cut(s) 39, 64
BstDEI CTNAG 1 cut(s) 95
BstKTI GATC 2 cut(s) 42, 67
BstMBI GATC 2 cut(s) 39, 64
BstMWI GCNNNNNNNGC 1 cut(s) 232
BstNSI RCATGY 1 cut(s) 230
BstSFI CTRYAG 1 cut(s) 6
BstV2I GAAGAC 1 cut(s) 287
CaiI CAGNNNCTG 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 252
CviAII CATG 2 cut(s) 136, 227
CviJI RGCY 3 cut(s) 50, 94, 155
CviKI_1 RGCY 3 cut(s) 50, 94, 155
DdeI CTNAG 1 cut(s) 95
DpnI GATC 2 cut(s) 41, 66
DpnII GATC 2 cut(s) 39, 64
Eco47I GGWCC 1 cut(s) 252
Eco57I CTGAAG 2 cut(s) 96, 281
FaeI CATG 2 cut(s) 139, 230
FaqI GGGAC 1 cut(s) 340
FatI CATG 2 cut(s) 135, 226
FauI CCCGC 1 cut(s) 13
FspBI CTAG 1 cut(s) 62
Hin1II CATG 2 cut(s) 139, 230
Hpy188I TCNGA 2 cut(s) 274, 300
Hpy188III TCNNGA 2 cut(s) 62, 368
HpyAV CCTTC 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 358
HpyCH4V TGCA 3 cut(s) 8, 116, 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
HpyF3I CTNAG 1 cut(s) 95
HpySE526I ACGT 1 cut(s) 358
Hsp92II CATG 2 cut(s) 139, 230
Kzo9I GATC 2 cut(s) 39, 64
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 6 cut(s) 36, 137, 217, 246, 251, 354
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 62
MaeII ACGT 1 cut(s) 358
MaeIII GTNAC 2 cut(s) 147, 365
MalI GATC 2 cut(s) 41, 66
MbiI CCGCTC 1 cut(s) 20
MboI GATC 2 cut(s) 39, 64
MboII GAAGA 1 cut(s) 287
MluCI AATT 3 cut(s) 11, 247, 301
MmeI TCCRAC 1 cut(s) 145
MwoI GCNNNNNNNGC 1 cut(s) 232
NdeII GATC 2 cut(s) 39, 64
NlaIII CATG 2 cut(s) 139, 230
NlaIV GGNNCC 2 cut(s) 236, 339
NmuCI GTSAC 1 cut(s) 365
NspI RCATGY 1 cut(s) 230
PsiI TTATAA 1 cut(s) 245
PspN4I GGNNCC 2 cut(s) 236, 339
PspPI GGNCC 1 cut(s) 252
PstI CTGCAG 1 cut(s) 10
PstNI CAGNNNCTG 1 cut(s) 102
Sau3AI GATC 2 cut(s) 39, 64
Sau96I GGNCC 1 cut(s) 252
SetI ASST 3 cut(s) 52, 59, 361
SfaNI GCATC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 6
SinI GGWCC 1 cut(s) 252
Sse9I AATT 3 cut(s) 11, 247, 301
SsiI CCGC 1 cut(s) 20
SspI AATATT 1 cut(s) 317
SspMI CTAG 1 cut(s) 62
TaiI ACGT 1 cut(s) 361
TasI AATT 3 cut(s) 11, 247, 301
TseFI GTSAC 1 cut(s) 365
Tsp45I GTSAC 1 cut(s) 365
TspDTI ATGAA 1 cut(s) 258
VpaK11BI GGWCC 1 cut(s) 252
XapI RAATTY 2 cut(s) 11, 301
XbaI TCTAGA 1 cut(s) 61
XceI RCATGY 1 cut(s) 230
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.