Rmu_co8010262.1_g000001

Ferric-chelate reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8010262.1
Physical Location & Seq
Forward (+)
1 .. 532
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8010262.1_g000001.1.cds

Sequence Viewer

Length: 280 bp
ccatagtgaattcccaaacagattcctgcagctcaagtctaaacctccggagtgtcaatctgccctttgatgcagcttccctcaactgcgatgctgtgtgggattctcagggttacatcctcagatactcacagaccacaccaggaacatggacctttgttctctcagcacctgcagcaaattcctacatagcaatggggttctcaagcaatggccagatgacggggtccagtgcgattgtggggtgggtgtcctcaacagagggaggagtaattaagcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

9.8

Weight (kDa)

4.78

Isoelectric Point (pI)

52.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 180
Acc36I ACCTGC 1 cut(s) 180
AccIII TCCGGA 1 cut(s) 47
AcoI YGGCCR 1 cut(s) 213
AcsI RAATTY 2 cut(s) 9, 180
AfiI CCNNNNNNNGG 1 cut(s) 222
AjnI CCWGG 1 cut(s) 141
AluBI AGCT 2 cut(s) 32, 76
AluI AGCT 2 cut(s) 32, 76
AlwNI CAGNNNCTG 1 cut(s) 172
Aor13HI TCCGGA 1 cut(s) 47
AoxI GGCC 1 cut(s) 213
ApeKI GCWGC 3 cut(s) 29, 73, 175
ApoI RAATTY 2 cut(s) 9, 180
AspS9I GGNCC 2 cut(s) 152, 227
AvaII GGWCC 2 cut(s) 152, 227
BalI TGGCCA 1 cut(s) 215
BbvI GCAGC 3 cut(s) 41, 85, 187
BciT130I CCWGG 1 cut(s) 143
BfmI CTRYAG 2 cut(s) 27, 173
BfuAI ACCTGC 1 cut(s) 180
BisI GCNGC 3 cut(s) 30, 74, 176
BlsI GCNGC 3 cut(s) 31, 75, 177
Bme1390I CCNGG 1 cut(s) 143
Bme18I GGWCC 2 cut(s) 152, 227
BmgT120I GGNCC 2 cut(s) 152, 227
BmiI GGNNCC 1 cut(s) 228
BmrFI CCNGG 1 cut(s) 143
BmsI GCATC 2 cut(s) 60, 81
BpuEI CTTGAG 2 cut(s) 18, 189
BsaWI WCCGGW 1 cut(s) 47
Bsc4I CCNNNNNNNGG 1 cut(s) 222
Bse1I ACTGG 1 cut(s) 230
Bse3DI GCAATG 2 cut(s) 200, 216
BseAI TCCGGA 1 cut(s) 47
BseBI CCWGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 116
BseLI CCNNNNNNNGG 1 cut(s) 222
BseMI GCAATG 2 cut(s) 200, 216
BseMII CTCAG 3 cut(s) 121, 135, 179
BseNI ACTGG 1 cut(s) 230
BseXI GCAGC 3 cut(s) 41, 85, 187
BshFI GGCC 1 cut(s) 215
BsiSI CCGG 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 222
BsnI GGCC 1 cut(s) 215
Bsp13I TCCGGA 1 cut(s) 47
BspANI GGCC 1 cut(s) 215
BspCNI CTCAG 3 cut(s) 120, 134, 178
BspEI TCCGGA 1 cut(s) 47
BspLI GGNNCC 1 cut(s) 228
BspMAI CTGCAG 2 cut(s) 31, 177
BspMI ACCTGC 1 cut(s) 180
BsrDI GCAATG 2 cut(s) 200, 216
BsrI ACTGG 1 cut(s) 230
Bst2UI CCWGG 1 cut(s) 143
BstDEI CTNAG 3 cut(s) 107, 121, 165
BstF5I GGATG 1 cut(s) 116
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstSFI CTRYAG 2 cut(s) 27, 173
BstV1I GCAGC 3 cut(s) 41, 85, 187
BstXI CCANNNNNNTGG 1 cut(s) 149
BsuRI GGCC 1 cut(s) 215
BtgZI GCGATG 1 cut(s) 104
BtsCI GGATG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 237
BveI ACCTGC 1 cut(s) 180
CaiI CAGNNNCTG 1 cut(s) 172
Cfr13I GGNCC 2 cut(s) 152, 227
CviAII CATG 1 cut(s) 149
CviJI RGCY 3 cut(s) 32, 76, 215
CviKI_1 RGCY 3 cut(s) 32, 76, 215
DdeI CTNAG 3 cut(s) 107, 121, 165
EaeI YGGCCR 1 cut(s) 213
Eco47I GGWCC 2 cut(s) 152, 227
EcoRI GAATTC 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 141
FaeI CATG 1 cut(s) 152
FaiI YATR 3 cut(s) 4, 150, 190
FatI CATG 1 cut(s) 148
Fnu4HI GCNGC 3 cut(s) 30, 74, 176
FokI GGATG 1 cut(s) 103
Fsp4HI GCNGC 3 cut(s) 30, 74, 176
GluI GCNGC 3 cut(s) 30, 74, 176
HaeIII GGCC 1 cut(s) 215
HapII CCGG 1 cut(s) 48
Hin1II CATG 1 cut(s) 152
HinfI GANTC 2 cut(s) 22, 103
HpaII CCGG 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 48
HpyCH4V TGCA 3 cut(s) 29, 73, 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 3 cut(s) 107, 121, 165
Hsp92II CATG 1 cut(s) 152
Kpn2I TCCGGA 1 cut(s) 47
LpnPI CCDG 8 cut(s) 39, 61, 94, 128, 155, 185, 229, 243
Lsp1109I GCAGC 3 cut(s) 41, 85, 187
LweI GCATC 2 cut(s) 60, 81
MaeIII GTNAC 1 cut(s) 112
MlsI TGGCCA 1 cut(s) 215
MluCI AATT 3 cut(s) 9, 180, 272
MluNI TGGCCA 1 cut(s) 215
MnlI CCTC 6 cut(s) 55, 91, 130, 255, 259, 264
Mox20I TGGCCA 1 cut(s) 215
MroI TCCGGA 1 cut(s) 47
MscI TGGCCA 1 cut(s) 215
MseI TTAA 1 cut(s) 275
MslI CAYNNNNRTG 1 cut(s) 193
Msp20I TGGCCA 1 cut(s) 215
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 175
NlaIII CATG 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 228
PaqCI CACCTGC 1 cut(s) 180
PfeI GAWTC 2 cut(s) 22, 103
PflFI GACNNNGTC 1 cut(s) 225
PkrI GCNGC 3 cut(s) 31, 75, 177
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 228
PspPI GGNCC 2 cut(s) 152, 227
PstI CTGCAG 2 cut(s) 31, 177
PstNI CAGNNNCTG 1 cut(s) 172
PsyI GACNNNGTC 1 cut(s) 225
RseI CAYNNNNRTG 1 cut(s) 193
SaqAI TTAA 1 cut(s) 275
SatI GCNGC 3 cut(s) 30, 74, 176
Sau96I GGNCC 2 cut(s) 152, 227
ScrFI CCNGG 1 cut(s) 143
SetI ASST 5 cut(s) 34, 47, 78, 157, 174
SfaNI GCATC 2 cut(s) 60, 81
SfcI CTRYAG 2 cut(s) 27, 173
SinI GGWCC 2 cut(s) 152, 227
SmiMI CAYNNNNRTG 1 cut(s) 193
SmlI CTYRAG 2 cut(s) 33, 204
SmoI CTYRAG 2 cut(s) 33, 204
Sse9I AATT 3 cut(s) 9, 180, 272
StyD4I CCNGG 1 cut(s) 141
TasI AATT 3 cut(s) 9, 180, 272
TfiI GAWTC 2 cut(s) 22, 103
Tru1I TTAA 1 cut(s) 275
Tru9I TTAA 1 cut(s) 275
TscAI CASTG 1 cut(s) 237
TseI GCWGC 3 cut(s) 29, 73, 175
TspRI CASTG 1 cut(s) 237
Tth111I GACNNNGTC 1 cut(s) 225
VpaK11BI GGWCC 2 cut(s) 152, 227
XapI RAATTY 2 cut(s) 9, 180
XcmI CCANNNNNNNNNTGG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.