Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8360785.1

Orthogroup ID

OG0005090

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 948

Gene Structure 948 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8360785.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 424 bp

gtcaaacatcgagcacaggaagtccatatacaagattaagaaggagccatggagcactgaatatgcttggatggggcattttgatgataattggagtgtcatttgtggatttgtcttagacaataagactaaagctgatgtctccacccacaaagctcttggtatcttcattcttgtgcttggatgtcttcaggtgatggcatttttggctcgaccagataaggtatcgaaagcacgaaaatactggaattggtaccatcaaagcgtgggaaggcttctgattattcttgcagttgcaaatgttttctatggaatccatgtgggagaagaaggaacagcatggaatgctggatatggagctgttcttgctatcttggttgttattgctgttattctcgaattaaaattgtggtttagaaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cytochrom_B561 DOMON

Protein Analysis

140

Amino Acids

15.98

Weight (kDa)

9.39

Isoelectric Point (pI)

36.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005090)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G07570
fragaria_vesca	FvH4_2g17300
malus_domestica	MD05G1151900.v1.1 MD10G1146200.v1.1
prunus_persica	Prupe.1G238000_v2.0.a1 Prupe.8G184600_v2.0.a1 Prupe.8G184600_v2.0.a1 Prupe.8G184600_v2.0.a1
pyrus_communis	pycom05g14640 pycom10g12600 pycom10g12610
rosa_chinensis	RchiOBHm_Chr6g0281811
rosa_laevigata	RLG00000012927
rosa_multiflora	Rmu_co8010262.1_g000001 Rmu_co8360785.1_g000001 Rmu_ssc0000126.1_g000040
rosa_roxburghii	Rroxscaffold_7G00186760
rosa_rugosa	Rorug06G0143700
rosa_samantha	Rh2AG280900 Rh3AG033700 Rh3BG033900 Rh3CG032600 Rh3DG033700 Rh6AG256800 Rh6BG260000 Rh6CG258900 Rh6DG251000 Rh7AG303800 Rh7CG322300
rosa_wichuraiana	Rw6G022250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	253
AccB1I	GGYRCC	1 cut(s)	253
AcuI	CTGAAG	1 cut(s)	174
AfaI	GTAC	1 cut(s)	255
AluBI	AGCT	3 cut(s)	135, 156, 360
AluI	AGCT	3 cut(s)	135, 156, 360
Alw21I	GWGCWC	2 cut(s)	16, 57
Alw26I	GTCTC	1 cut(s)	146
Asp718I	GGTACC	1 cut(s)	253
AsuHPI	GGTGA	1 cut(s)	206
BanI	GGYRCC	1 cut(s)	253
BarI	GAAGNNNNNNTAC	2 cut(s)	12, 44
BbsI	GAAGAC	1 cut(s)	180
Bbv12I	GWGCWC	2 cut(s)	16, 57
BccI	CCATC	3 cut(s)	65, 191, 265
BcoDI	GTCTC	1 cut(s)	146
BmiI	GGNNCC	2 cut(s)	46, 255
BpiI	GAAGAC	1 cut(s)	180
BsaJI	CCNNGG	1 cut(s)	48
Bse1I	ACTGG	1 cut(s)	249
BseDI	CCNNGG	1 cut(s)	48
BseGI	GGATG	2 cut(s)	76, 189
BseNI	ACTGG	1 cut(s)	249
BshNI	GGYRCC	1 cut(s)	253
BsiHKAI	GWGCWC	2 cut(s)	16, 57
BsmAI	GTCTC	1 cut(s)	146
BsmI	GAATGC	1 cut(s)	350
Bsp1286I	GDGCHC	2 cut(s)	16, 57
Bsp19I	CCATGG	1 cut(s)	48
BspLI	GGNNCC	2 cut(s)	46, 255
BspT107I	GGYRCC	1 cut(s)	253
BsrI	ACTGG	1 cut(s)	249
BssECI	CCNNGG	1 cut(s)	48
BssT1I	CCWWGG	1 cut(s)	48
BstAPI	GCANNNNNTGC	1 cut(s)	345
BstDEI	CTNAG	1 cut(s)	116
BstDSI	CCRYGG	1 cut(s)	48
BstF5I	GGATG	2 cut(s)	76, 189
BstMAI	GTCTC	1 cut(s)	146
BstMWI	GCNNNNNNNGC	3 cut(s)	207, 345, 366
BstV2I	GAAGAC	1 cut(s)	180
BtgI	CCRYGG	1 cut(s)	48
BtsCI	GGATG	2 cut(s)	76, 189
BtsIMutI	CAGTG	1 cut(s)	55
Csp6I	GTAC	1 cut(s)	254
CviAII	CATG	3 cut(s)	49, 318, 340
CviJI	RGCY	6 cut(s)	47, 135, 156, 210, 275, 360
CviKI_1	RGCY	6 cut(s)	47, 135, 156, 210, 275, 360
CviQI	GTAC	1 cut(s)	254
DdeI	CTNAG	1 cut(s)	116
Eco130I	CCWWGG	1 cut(s)	48
Eco57I	CTGAAG	1 cut(s)	174
EcoT14I	CCWWGG	1 cut(s)	48
ErhI	CCWWGG	1 cut(s)	48
FaeI	CATG	3 cut(s)	52, 321, 343
FaiI	YATR	8 cut(s)	27, 29, 50, 64, 310, 319, 341, 355
FatI	CATG	3 cut(s)	48, 317, 339
FokI	GGATG	2 cut(s)	83, 196
Hin1II	CATG	3 cut(s)	52, 321, 343
HinfI	GANTC	1 cut(s)	313
HphI	GGTGA	1 cut(s)	206
Hpy188I	TCNGA	1 cut(s)	280
Hpy188III	TCNNGA	1 cut(s)	396
HpyAV	CCTTC	3 cut(s)	35, 265, 324
HpyCH4V	TGCA	2 cut(s)	291, 297
HpyF10VI	GCNNNNNNNGC	3 cut(s)	207, 345, 366
HpyF3I	CTNAG	1 cut(s)	116
Hsp92II	CATG	3 cut(s)	52, 321, 343
KpnI	GGTACC	1 cut(s)	257
LmnI	GCTCC	3 cut(s)	44, 52, 357
LpnPI	CCDG	5 cut(s)	2, 177, 229, 230, 334
MboII	GAAGA	3 cut(s)	158, 180, 339
MhlI	GDGCHC	2 cut(s)	16, 57
MluCI	AATT	4 cut(s)	89, 248, 399, 405
MseI	TTAA	2 cut(s)	37, 402
MslI	CAYNNNNRTG	2 cut(s)	82, 174
Mva1269I	GAATGC	1 cut(s)	350
MwoI	GCNNNNNNNGC	3 cut(s)	207, 345, 366
NcoI	CCATGG	1 cut(s)	48
NlaIII	CATG	3 cut(s)	52, 321, 343
NlaIV	GGNNCC	2 cut(s)	46, 255
PctI	GAATGC	1 cut(s)	350
PfeI	GAWTC	1 cut(s)	313
PspN4I	GGNNCC	2 cut(s)	46, 255
RsaI	GTAC	1 cut(s)	255
RsaNI	GTAC	1 cut(s)	254
RseI	CAYNNNNRTG	2 cut(s)	82, 174
SaqAI	TTAA	2 cut(s)	37, 402
SduI	GDGCHC	2 cut(s)	16, 57
SetI	ASST	5 cut(s)	137, 158, 196, 226, 362
SmiMI	CAYNNNNRTG	2 cut(s)	82, 174
Sse9I	AATT	4 cut(s)	89, 248, 399, 405
StyI	CCWWGG	1 cut(s)	48
TaqI	TCGA	4 cut(s)	10, 212, 228, 397
TasI	AATT	4 cut(s)	89, 248, 399, 405
TfiI	GAWTC	1 cut(s)	313
Tru1I	TTAA	2 cut(s)	37, 402
Tru9I	TTAA	2 cut(s)	37, 402
TscAI	CASTG	1 cut(s)	62
TspDTI	ATGAA	1 cut(s)	158
TspRI	CASTG	1 cut(s)	62
XcmI	CCANNNNNNNNNTGG	1 cut(s)	156

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.