Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8036242.1

Orthogroup ID

OG0011698

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 536

Gene Structure 536 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8036242.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

gctgcaagctttggaggaaccaactttgatccatctgcttgggaagacaagaaatgccctggtgaatcgcgcttccctgctcaggtgaaagttctaacgaggaaagtctgtgaaccactggaagaggattccttcaggccaattcttcatcactacgatggccctaaattccgtcttgaactcagcgtgccagaggccctctctctgttggatatatttgcagaccaagatgatatatttgtaactgaaaccccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Dev_Cell_Death

Protein Analysis

85

Amino Acids

9.57

Weight (kDa)

4.61

Isoelectric Point (pI)

48.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011698)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G42050
fragaria_vesca	FvH4_5g04970
malus_domestica	MD06G1110600.v1.1 MD14G1131300.v1.1
prunus_persica	Prupe.5G123200_v2.0.a1 Prupe.5G123200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0194091
rosa_laevigata	RLG00000004218
rosa_multiflora	Rmu_co8036242.1_g000001 Rmu_co8391571.1_g000001 Rmu_sc0003468.1_g000005 Rmu_sc0009433.1_g000003
rosa_roxburghii	Rroxscaffold_3G00261560
rosa_rugosa	Rorug07G0013700
rosa_samantha	Rh7AG140800 Rh7BG141500 Rh7CG144900 Rh7DG142300
rosa_wichuraiana	Rw7G012040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	70
AclWI	GGATC	1 cut(s)	23
AcsI	RAATTY	1 cut(s)	167
AcuI	CTGAAG	1 cut(s)	118
AfiI	CCNNNNNNNGG	1 cut(s)	82
AgsI	TTSAA	1 cut(s)	179
AjnI	CCWGG	1 cut(s)	58
AluBI	AGCT	1 cut(s)	9
AluI	AGCT	1 cut(s)	9
AlwI	GGATC	1 cut(s)	23
AoxI	GGCC	3 cut(s)	137, 160, 195
ApeKI	GCWGC	1 cut(s)	2
ApoI	RAATTY	1 cut(s)	167
AspLEI	GCGC	1 cut(s)	72
AspS9I	GGNCC	2 cut(s)	161, 196
AsuHPI	GGTGA	2 cut(s)	74, 97
BbsI	GAAGAC	1 cut(s)	51
BccI	CCATC	2 cut(s)	40, 152
BciT130I	CCWGG	1 cut(s)	60
BisI	GCNGC	1 cut(s)	3
BlsI	GCNGC	1 cut(s)	4
Bme1390I	CCNGG	1 cut(s)	60
BmgT120I	GGNCC	2 cut(s)	161, 196
BmiI	GGNNCC	1 cut(s)	19
BmrFI	CCNGG	1 cut(s)	60
BpiI	GAAGAC	1 cut(s)	51
BplI	GAGNNNNNCTC	2 cut(s)	185, 217
Bpu10I	CCTNAGC	1 cut(s)	81
BsaJI	CCNNGG	1 cut(s)	58
Bsc4I	CCNNNNNNNGG	1 cut(s)	82
Bse1I	ACTGG	1 cut(s)	123
BseBI	CCWGG	1 cut(s)	60
BseDI	CCNNGG	1 cut(s)	58
BseLI	CCNNNNNNNGG	1 cut(s)	82
BseMII	CTCAG	2 cut(s)	95, 196
BseNI	ACTGG	1 cut(s)	123
Bsh1236I	CGCG	1 cut(s)	70
BshFI	GGCC	3 cut(s)	139, 162, 197
BslI	CCNNNNNNNGG	1 cut(s)	82
BsnI	GGCC	3 cut(s)	139, 162, 197
Bsp143I	GATC	1 cut(s)	28
BspANI	GGCC	3 cut(s)	139, 162, 197
BspCNI	CTCAG	2 cut(s)	94, 195
BspFNI	CGCG	1 cut(s)	70
BspLI	GGNNCC	1 cut(s)	19
BspPI	GGATC	1 cut(s)	23
BsrI	ACTGG	1 cut(s)	123
BssECI	CCNNGG	1 cut(s)	58
BssMI	GATC	1 cut(s)	28
Bst2UI	CCWGG	1 cut(s)	60
Bst6I	CTCTTC	1 cut(s)	117
BstC8I	GCNNGC	2 cut(s)	7, 188
BstDEI	CTNAG	2 cut(s)	81, 182
BstFNI	CGCG	1 cut(s)	70
BstHHI	GCGC	1 cut(s)	72
BstKTI	GATC	1 cut(s)	31
BstMBI	GATC	1 cut(s)	28
BstNI	CCWGG	1 cut(s)	60
BstSCI	CCNGG	1 cut(s)	58
BstUI	CGCG	1 cut(s)	70
BstV2I	GAAGAC	1 cut(s)	51
BstXI	CCANNNNNNTGG	1 cut(s)	39
BsuRI	GGCC	3 cut(s)	139, 162, 197
BtsIMutI	CAGTG	1 cut(s)	116
Cac8I	GCNNGC	2 cut(s)	7, 188
CfoI	GCGC	1 cut(s)	72
Cfr13I	GGNCC	2 cut(s)	161, 196
CviJI	RGCY	4 cut(s)	9, 139, 162, 197
CviKI_1	RGCY	4 cut(s)	9, 139, 162, 197
DdeI	CTNAG	2 cut(s)	81, 182
DpnI	GATC	1 cut(s)	30
DpnII	GATC	1 cut(s)	28
Eam1104I	CTCTTC	1 cut(s)	117
EarI	CTCTTC	1 cut(s)	117
Eco57I	CTGAAG	1 cut(s)	118
EcoO109I	RGGNCCY	1 cut(s)	196
EcoRII	CCWGG	1 cut(s)	58
FaiI	YATR	2 cut(s)	215, 236
Fnu4HI	GCNGC	1 cut(s)	3
Fsp4HI	GCNGC	1 cut(s)	3
GlaI	GCGC	1 cut(s)	71
GluI	GCNGC	1 cut(s)	3
HaeIII	GGCC	3 cut(s)	139, 162, 197
HhaI	GCGC	1 cut(s)	72
Hin6I	GCGC	1 cut(s)	70
HinP1I	GCGC	1 cut(s)	70
HindIII	AAGCTT	1 cut(s)	7
HinfI	GANTC	2 cut(s)	65, 128
HphI	GGTGA	2 cut(s)	74, 97
Hpy166II	GTNNAC	1 cut(s)	113
Hpy188III	TCNNGA	1 cut(s)	176
Hpy8I	GTNNAC	1 cut(s)	113
HpyAV	CCTTC	1 cut(s)	142
HpyCH4V	TGCA	2 cut(s)	5, 221
HpyF3I	CTNAG	2 cut(s)	81, 182
HspAI	GCGC	1 cut(s)	70
Kzo9I	GATC	1 cut(s)	28
LpnPI	CCDG	7 cut(s)	45, 68, 72, 90, 104, 121, 204
MaeIII	GTNAC	1 cut(s)	241
MalI	GATC	1 cut(s)	30
MboI	GATC	1 cut(s)	28
MboII	GAAGA	3 cut(s)	56, 134, 137
MluCI	AATT	2 cut(s)	141, 167
MmeI	TCCRAC	1 cut(s)	189
MnlI	CCTC	5 cut(s)	8, 93, 118, 187, 209
MslI	CAYNNNNRTG	1 cut(s)	156
MspR9I	CCNGG	1 cut(s)	60
MvaI	CCWGG	1 cut(s)	60
MvnI	CGCG	1 cut(s)	70
NdeII	GATC	1 cut(s)	28
NlaIV	GGNNCC	1 cut(s)	19
PfeI	GAWTC	2 cut(s)	65, 128
PkrI	GCNGC	1 cut(s)	4
Psp6I	CCWGG	1 cut(s)	58
PspGI	CCWGG	1 cut(s)	58
PspN4I	GGNNCC	1 cut(s)	19
PspPI	GGNCC	2 cut(s)	161, 196
RseI	CAYNNNNRTG	1 cut(s)	156
SatI	GCNGC	1 cut(s)	3
Sau3AI	GATC	1 cut(s)	28
Sau96I	GGNCC	2 cut(s)	161, 196
ScrFI	CCNGG	1 cut(s)	60
SetI	ASST	2 cut(s)	11, 87
SmiMI	CAYNNNNRTG	1 cut(s)	156
Sse9I	AATT	2 cut(s)	141, 167
StyD4I	CCNGG	1 cut(s)	58
TasI	AATT	2 cut(s)	141, 167
TfiI	GAWTC	2 cut(s)	65, 128
TscAI	CASTG	1 cut(s)	123
TseI	GCWGC	1 cut(s)	2
TspDTI	ATGAA	1 cut(s)	137
TspGWI	ACGGA	1 cut(s)	161
TspRI	CASTG	1 cut(s)	123
XapI	RAATTY	1 cut(s)	167

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.