Rmu_co8060368.1_g000001

Heterogeneous nuclear ribonucleoprotein 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8060368.1
Physical Location & Seq
Reverse (-)
2 .. 438
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8060368.1_g000001.1.cds

Sequence Viewer

Length: 437 bp
atggagattgatgtgaaacaagcccaagttcaaggattttctaacaattccaagaggatttttgtgggaggtctaccacatgatctaagagatgaagaattcaagaactactttgagaagtttggtaaaattacagattgggatgtaatgtttgataaggaaaaccacaaacctagggggtttggattcatcacttatgagtcagaggaggctgtgcatgatgtgttgcagaagaggtttcatgacttgaatcacaagtctgtagaggtaaagagagctcaccctcagaataggaataacaacaggctcatgaaacagtatgatcgctacaatgtagctcctaatgggtatagatacggtgtagggtatacgtctggtaataatcctggaactttggggcattataatccatattgcagtagttatgtagcacctta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.95

Weight (kDa)

8.58

Isoelectric Point (pI)

33.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 405
AccI GTMKAC 2 cut(s) 73, 368
AcsI RAATTY 1 cut(s) 98
AgsI TTSAA 3 cut(s) 32, 103, 250
AjnI CCWGG 1 cut(s) 385
AluBI AGCT 2 cut(s) 278, 338
AluI AGCT 2 cut(s) 278, 338
Alw21I GWGCWC 1 cut(s) 280
ApoI RAATTY 1 cut(s) 98
AspA2I CCTAGG 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 272
AvrII CCTAGG 1 cut(s) 173
BanII GRGCYC 1 cut(s) 280
Bbv12I GWGCWC 1 cut(s) 280
BciT130I CCWGG 1 cut(s) 387
BfaI CTAG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 261
BlnI CCTAGG 1 cut(s) 173
Bme1390I CCNGG 1 cut(s) 387
BmrFI CCNGG 1 cut(s) 387
BsaJI CCNNGG 1 cut(s) 173
BseBI CCWGG 1 cut(s) 387
BseDI CCNNGG 1 cut(s) 173
BseGI GGATG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 299
BseRI GAGGAG 1 cut(s) 221
BsiHKAI GWGCWC 1 cut(s) 280
Bsp1286I GDGCHC 1 cut(s) 280
Bsp143I GATC 2 cut(s) 82, 322
BspCNI CTCAG 1 cut(s) 298
BspHI TCATGA 2 cut(s) 241, 309
BssECI CCNNGG 1 cut(s) 173
BssMI GATC 2 cut(s) 82, 322
BssNAI GTATAC 1 cut(s) 369
BssT1I CCWWGG 1 cut(s) 173
Bst1107I GTATAC 1 cut(s) 369
Bst2UI CCWGG 1 cut(s) 387
Bst4CI ACNGT 2 cut(s) 318, 359
Bst6I CTCTTC 1 cut(s) 227
BstDEI CTNAG 2 cut(s) 86, 285
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 2 cut(s) 85, 325
BstMBI GATC 2 cut(s) 82, 322
BstNI CCWGG 1 cut(s) 387
BstSCI CCNGG 1 cut(s) 385
BstSFI CTRYAG 1 cut(s) 261
BstZ17I GTATAC 1 cut(s) 369
BtsCI GGATG 1 cut(s) 148
CciI TCATGA 2 cut(s) 241, 309
CviAII CATG 4 cut(s) 80, 218, 242, 310
CviJI RGCY 5 cut(s) 23, 212, 278, 307, 338
CviKI_1 RGCY 5 cut(s) 23, 212, 278, 307, 338
DdeI CTNAG 2 cut(s) 86, 285
DpnI GATC 2 cut(s) 84, 324
DpnII GATC 2 cut(s) 82, 322
Eam1104I CTCTTC 1 cut(s) 227
EarI CTCTTC 1 cut(s) 227
Ecl136II GAGCTC 1 cut(s) 278
Eco130I CCWWGG 1 cut(s) 173
Eco24I GRGCYC 1 cut(s) 280
Eco53kI GAGCTC 1 cut(s) 278
EcoICRI GAGCTC 1 cut(s) 278
EcoRI GAATTC 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 385
EcoT14I CCWWGG 1 cut(s) 173
EcoT38I GRGCYC 1 cut(s) 280
ErhI CCWWGG 1 cut(s) 173
FaeI CATG 4 cut(s) 83, 221, 245, 313
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FatI CATG 4 cut(s) 79, 217, 241, 309
FblI GTMKAC 2 cut(s) 73, 368
FokI GGATG 1 cut(s) 155
FriOI GRGCYC 1 cut(s) 280
FspBI CTAG 1 cut(s) 174
Hin1II CATG 4 cut(s) 83, 221, 245, 313
HinfI GANTC 3 cut(s) 186, 200, 250
HphI GGTGA 1 cut(s) 272
Hpy166II GTNNAC 2 cut(s) 74, 369
Hpy188I TCNGA 2 cut(s) 205, 288
Hpy188III TCNNGA 3 cut(s) 103, 242, 310
Hpy8I GTNNAC 2 cut(s) 74, 369
HpyCH4III ACNGT 2 cut(s) 318, 359
HpyCH4IV ACGT 1 cut(s) 371
HpyCH4V TGCA 3 cut(s) 217, 229, 417
HpyF3I CTNAG 2 cut(s) 86, 285
HpySE526I ACGT 1 cut(s) 371
Hsp92II CATG 4 cut(s) 83, 221, 245, 313
Kzo9I GATC 2 cut(s) 82, 322
LmnI GCTCC 1 cut(s) 343
LpnPI CCDG 4 cut(s) 289, 360, 372, 399
MaeI CTAG 1 cut(s) 174
MaeII ACGT 1 cut(s) 371
MalI GATC 2 cut(s) 84, 324
MboI GATC 2 cut(s) 82, 322
MboII GAAGA 2 cut(s) 107, 244
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 3 cut(s) 46, 98, 129
MlyI GAGTC 1 cut(s) 209
MnlI CCTC 7 cut(s) 48, 62, 199, 202, 228, 259, 294
MspR9I CCNGG 1 cut(s) 387
MvaI CCWGG 1 cut(s) 387
NdeII GATC 2 cut(s) 82, 322
NlaIII CATG 4 cut(s) 83, 221, 245, 313
PagI TCATGA 2 cut(s) 241, 309
PfeI GAWTC 2 cut(s) 186, 250
PfoI TCCNGGA 1 cut(s) 385
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PsiI TTATAA 1 cut(s) 405
Psp124BI GAGCTC 1 cut(s) 280
Psp6I CCWGG 1 cut(s) 385
PspGI CCWGG 1 cut(s) 385
SacI GAGCTC 1 cut(s) 280
Sau3AI GATC 2 cut(s) 82, 322
SchI GAGTC 1 cut(s) 209
ScrFI CCNGG 1 cut(s) 387
SduI GDGCHC 1 cut(s) 280
SetI ASST 8 cut(s) 73, 175, 239, 270, 280, 340, 374, 436
SfcI CTRYAG 1 cut(s) 261
Sse9I AATT 3 cut(s) 46, 98, 129
SspMI CTAG 1 cut(s) 174
SstI GAGCTC 1 cut(s) 280
StyD4I CCNGG 1 cut(s) 385
StyI CCWWGG 1 cut(s) 173
TaaI ACNGT 2 cut(s) 318, 359
TaiI ACGT 1 cut(s) 374
TasI AATT 3 cut(s) 46, 98, 129
TfiI GAWTC 2 cut(s) 186, 250
TspDTI ATGAA 4 cut(s) 108, 178, 230, 326
XapI RAATTY 1 cut(s) 98
XmaJI CCTAGG 1 cut(s) 173
XmiI GTMKAC 2 cut(s) 73, 368
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.