Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003910.1

Orthogroup ID

OG0006429

Physical Location & Seq

Genomic Coordinates Reverse (-)

3356 .. 4767

Gene Structure 1412 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003910.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1038 bp

atggagattgatgtgaaacaagcccaagttcaaggattttctaacaattccaagaggatttttgtgggaggtctaccacatgatctaagagatgaagaattcaagaactactttgagaagtttggtaaaattacagattgggatgtaatgtttgataaggaaaaccacaaacctagggggtttggattcatcacttatgagtcagaggaggctgtgcatgatgtgttgcagaagaggtttcatgacttgaatcacaagtctgtagaggtaaagagagctcaccctcagaataggaataacaacaggctcatgaaacagtatgatcgctacaatgtagctcctaatggatatggtgctgggtttttgcacgatccgaatccttataatgcttgggtatatacagctgattatggcttatggggtggtcagaatgctaacaactccaatatccgaagctggacggagcttcctgatgatgttaccgcaatgatactgtcacgtctaggtgcaattgagatcttgaaaactgctcagaaggtttgcatgacatggcgcaaaataagcaaggaccctcttatgtggtgcagaatcgacttgcacaacgatggttcttattatagtcagttggacaaaatgtgccgccaagccattgatcgtaggctcgtagctgtggtaaactggtcgatatcagcatccagaaatttggcaatgatgcacgtcttgagtatatcactgatagggcgctcttgccctctcttaacatcaatgaagtataaggacggatggcaggtatggttcaaatttgatgatactaatgaacaagcacttgccatagccggaacaatgcatggtttacgctacctccagcttttagggaatggggtgactaatgatggattggccaagatccttgattcttgtcctcatctcgagtcacttgatctgagatattgtttcaatcttaatttgggaggagatttgcagagaagatgttctacacaagttaaaacacatcaacttcccggaggatcattgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like LRR_6

Protein Analysis

345

Amino Acids

39.61

Weight (kDa)

8.56

Isoelectric Point (pI)

41.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006429)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0015111 RchiOBHm_Chr6g0277551
rosa_laevigata	RLG00000013293 RLG00000032172
rosa_multiflora	Rmu_co8060368.1_g000001 Rmu_co8498617.1_g000001 Rmu_sc0001846.1_g000030 Rmu_sc0002209.1_g000005 Rmu_sc0002209.1_g000006 Rmu_sc0003910.1_g000002
rosa_roxburghii	Rroxscaffold_1G00061410 Rroxscaffold_1G00061420 Rroxscaffold_7G00191220
rosa_rugosa	Rorug05G0024500 Rorug05G0024500 Rorug06G0109600 Rorug06G0109600
rosa_samantha	Rh5AG118800 Rh5BG116700 Rh5BG116800 Rh5CG127800 Rh5DG115700 Rh6AG220000 Rh6BG223900 Rh6CG226200 Rh6DG216800
rosa_wichuraiana	Rw6G019260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	384
Acc36I	ACCTGC	1 cut(s)	778
AccI	GTMKAC	1 cut(s)	73
AciI	CCGC	2 cut(s)	483, 640
AclWI	GGATC	3 cut(s)	365, 901, 1036
AcoI	YGGCCR	1 cut(s)	900
AcsI	RAATTY	3 cut(s)	98, 700, 800
AgsI	TTSAA	6 cut(s)	32, 103, 250, 523, 799, 958
AjiI	CACGTC	2 cut(s)	500, 718
AluBI	AGCT	7 cut(s)	278, 338, 404, 456, 466, 668, 868
AluI	AGCT	7 cut(s)	278, 338, 404, 456, 466, 668, 868
Alw21I	GWGCWC	1 cut(s)	280
AlwI	GGATC	3 cut(s)	365, 901, 1036
Ama87I	CYCGRG	1 cut(s)	929
AoxI	GGCC	1 cut(s)	900
ApoI	RAATTY	3 cut(s)	98, 700, 800
Asp700I	GAANNNNTTC	1 cut(s)	991
AspA2I	CCTAGG	1 cut(s)	173
AspLEI	GCGC	2 cut(s)	555, 744
AspS9I	GGNCC	1 cut(s)	568
AsuC2I	CCSGG	1 cut(s)	1023
AsuHPI	GGTGA	2 cut(s)	272, 895
AvaI	CYCGRG	1 cut(s)	929
AvaII	GGWCC	1 cut(s)	568
AvrII	CCTAGG	1 cut(s)	173
BalI	TGGCCA	1 cut(s)	902
BanII	GRGCYC	1 cut(s)	280
BarI	GAAGNNNNNNTAC	2 cut(s)	979, 1011
Bbv12I	GWGCWC	1 cut(s)	280
BccI	CCATC	3 cut(s)	599, 777, 887
BcnI	CCSGG	1 cut(s)	1023
BfaI	CTAG	2 cut(s)	174, 503
BfmI	CTRYAG	1 cut(s)	261
BfoI	RGCGCY	1 cut(s)	745
BfuAI	ACCTGC	1 cut(s)	778
BglII	AGATCT	1 cut(s)	516
BisI	GCNGC	1 cut(s)	640
BlnI	CCTAGG	1 cut(s)	173
BlsI	GCNGC	1 cut(s)	641
Bme1390I	CCNGG	1 cut(s)	1023
Bme18I	GGWCC	1 cut(s)	568
BmeT110I	CYCGRG	1 cut(s)	929
BmgBI	CACGTC	2 cut(s)	500, 718
BmgT120I	GGNCC	1 cut(s)	568
BmiI	GGNNCC	1 cut(s)	570
BmrFI	CCNGG	1 cut(s)	1023
BmsI	GCATC	2 cut(s)	701, 702
BpmI	CTGGAG	1 cut(s)	848
BpuEI	CTTGAG	1 cut(s)	742
BpuMI	CCSGG	1 cut(s)	1023
BsaBI	GATNNNNATC	1 cut(s)	375
BsaJI	CCNNGG	1 cut(s)	173
BsaXI	ACNNNNNCTCC	2 cut(s)	846, 876
Bse1I	ACTGG	1 cut(s)	683
Bse3DI	GCAATG	2 cut(s)	492, 714
Bse8I	GATNNNNATC	1 cut(s)	375
BseDI	CCNNGG	1 cut(s)	173
BseGI	GGATG	3 cut(s)	148, 692, 788
BseJI	GATNNNNATC	1 cut(s)	375
BseMI	GCAATG	2 cut(s)	492, 714
BseMII	CTCAG	3 cut(s)	299, 545, 935
BseNI	ACTGG	1 cut(s)	683
BseRI	GAGGAG	2 cut(s)	221, 987
BseYI	CCCAGC	1 cut(s)	356
BsgI	GTGCAG	1 cut(s)	604
BshFI	GGCC	1 cut(s)	902
BsiHKAI	GWGCWC	1 cut(s)	280
BsiHKCI	CYCGRG	1 cut(s)	929
BsiSI	CCGG	2 cut(s)	837, 1023
BsmI	GAATGC	1 cut(s)	436
BsnI	GGCC	1 cut(s)	902
BsoBI	CYCGRG	1 cut(s)	929
Bsp1286I	GDGCHC	1 cut(s)	280
Bsp143I	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
BspACI	CCGC	2 cut(s)	483, 640
BspANI	GGCC	1 cut(s)	902
BspCNI	CTCAG	3 cut(s)	298, 544, 936
BspHI	TCATGA	2 cut(s)	241, 309
BspLI	GGNNCC	1 cut(s)	570
BspMI	ACCTGC	1 cut(s)	778
BspPI	GGATC	3 cut(s)	365, 901, 1036
BsrDI	GCAATG	2 cut(s)	492, 714
BsrI	ACTGG	1 cut(s)	683
BssECI	CCNNGG	1 cut(s)	173
BssMI	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
BssT1I	CCWWGG	1 cut(s)	173
Bst4CI	ACNGT	2 cut(s)	318, 495
Bst6I	CTCTTC	1 cut(s)	227
BstDEI	CTNAG	4 cut(s)	86, 285, 531, 944
BstF5I	GGATG	3 cut(s)	148, 692, 788
BstH2I	RGCGCY	1 cut(s)	745
BstHHI	GCGC	2 cut(s)	555, 744
BstKTI	GATC	8 cut(s)	85, 325, 373, 519, 655, 909, 943, 1031
BstMBI	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
BstMWI	GCNNNNNNNGC	1 cut(s)	561
BstSCI	CCNGG	1 cut(s)	1021
BstSFI	CTRYAG	1 cut(s)	261
BstX2I	RGATCY	2 cut(s)	516, 906
BstXI	CCANNNNNNTGG	1 cut(s)	703
BstYI	RGATCY	2 cut(s)	516, 906
BsuRI	GGCC	1 cut(s)	902
BtrI	CACGTC	2 cut(s)	500, 718
BtsCI	GGATG	3 cut(s)	148, 692, 788
BtsIMutI	CAGTG	1 cut(s)	731
BveI	ACCTGC	1 cut(s)	778
CciI	TCATGA	2 cut(s)	241, 309
CfoI	GCGC	2 cut(s)	555, 744
Cfr13I	GGNCC	1 cut(s)	568
CviAII	CATG	7 cut(s)	80, 218, 242, 310, 544, 549, 848
DdeI	CTNAG	4 cut(s)	86, 285, 531, 944
DpnI	GATC	8 cut(s)	84, 324, 372, 518, 654, 908, 942, 1030
DpnII	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
EaeI	YGGCCR	1 cut(s)	900
Eam1104I	CTCTTC	1 cut(s)	227
EarI	CTCTTC	1 cut(s)	227
Ecl136II	GAGCTC	1 cut(s)	278
Eco130I	CCWWGG	1 cut(s)	173
Eco24I	GRGCYC	1 cut(s)	280
Eco32I	GATATC	1 cut(s)	687
Eco47I	GGWCC	1 cut(s)	568
Eco53kI	GAGCTC	1 cut(s)	278
Eco88I	CYCGRG	1 cut(s)	929
EcoICRI	GAGCTC	1 cut(s)	278
EcoO109I	RGGNCCY	1 cut(s)	568
EcoRI	GAATTC	1 cut(s)	98
EcoRV	GATATC	1 cut(s)	687
EcoT14I	CCWWGG	1 cut(s)	173
EcoT22I	ATGCAT	1 cut(s)	849
EcoT38I	GRGCYC	1 cut(s)	280
ErhI	CCWWGG	1 cut(s)	173
FaeI	CATG	7 cut(s)	83, 221, 245, 313, 547, 552, 851
FalI	AAGNNNNNCTT	2 cut(s)	95, 127
FatI	CATG	7 cut(s)	79, 217, 241, 309, 543, 548, 847
FblI	GTMKAC	1 cut(s)	73
Fnu4HI	GCNGC	1 cut(s)	640
FokI	GGATG	3 cut(s)	155, 679, 795
FriOI	GRGCYC	1 cut(s)	280
Fsp4HI	GCNGC	1 cut(s)	640
FspBI	CTAG	2 cut(s)	174, 503
GlaI	GCGC	2 cut(s)	554, 743
GluI	GCNGC	1 cut(s)	640
GsaI	CCCAGC	1 cut(s)	360
GsuI	CTGGAG	1 cut(s)	848
HaeII	RGCGCY	1 cut(s)	745
HaeIII	GGCC	1 cut(s)	902
HapII	CCGG	2 cut(s)	837, 1023
HhaI	GCGC	2 cut(s)	555, 744
Hin1II	CATG	7 cut(s)	83, 221, 245, 313, 547, 552, 851
Hin6I	GCGC	2 cut(s)	553, 742
HinP1I	GCGC	2 cut(s)	553, 742
HinfI	GANTC	7 cut(s)	186, 200, 250, 376, 588, 914, 932
HpaII	CCGG	2 cut(s)	837, 1023
HphI	GGTGA	2 cut(s)	272, 895
Hpy166II	GTNNAC	3 cut(s)	74, 676, 854
Hpy188I	TCNGA	7 cut(s)	205, 288, 375, 429, 452, 534, 945
Hpy188III	TCNNGA	8 cut(s)	103, 242, 310, 470, 520, 696, 721, 929
Hpy8I	GTNNAC	3 cut(s)	74, 676, 854
HpyAV	CCTTC	1 cut(s)	529
HpyCH4III	ACNGT	2 cut(s)	318, 495
HpyCH4IV	ACGT	2 cut(s)	499, 717
HpyF10VI	GCNNNNNNNGC	1 cut(s)	561
HpyF3I	CTNAG	4 cut(s)	86, 285, 531, 944
HpySE526I	ACGT	2 cut(s)	499, 717
Hsp92II	CATG	7 cut(s)	83, 221, 245, 313, 547, 552, 851
HspAI	GCGC	2 cut(s)	553, 742
Kzo9I	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
LmnI	GCTCC	2 cut(s)	343, 463
LpnPI	CCDG	9 cut(s)	289, 342, 442, 483, 664, 709, 773, 850, 878
LweI	GCATC	2 cut(s)	701, 702
MaeI	CTAG	2 cut(s)	174, 503
MaeII	ACGT	2 cut(s)	499, 717
MaeIII	GTNAC	4 cut(s)	478, 495, 883, 933
MalI	GATC	8 cut(s)	84, 324, 372, 518, 654, 908, 942, 1030
MboI	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
MboII	GAAGA	3 cut(s)	107, 244, 999
MfeI	CAATTG	1 cut(s)	510
MflI	RGATCY	2 cut(s)	516, 906
MhlI	GDGCHC	1 cut(s)	280
MlsI	TGGCCA	1 cut(s)	902
MluCI	AATT	7 cut(s)	46, 98, 129, 510, 700, 800, 964
MluNI	TGGCCA	1 cut(s)	902
MlyI	GAGTC	2 cut(s)	209, 941
MmeI	TCCRAC	1 cut(s)	606
Mox20I	TGGCCA	1 cut(s)	902
Mph1103I	ATGCAT	1 cut(s)	849
MroXI	GAANNNNTTC	1 cut(s)	991
MscI	TGGCCA	1 cut(s)	902
MseI	TTAA	3 cut(s)	758, 963, 1005
MslI	CAYNNNNRTG	1 cut(s)	603
Msp20I	TGGCCA	1 cut(s)	902
MspA1I	CMGCKG	1 cut(s)	404
MspI	CCGG	2 cut(s)	837, 1023
MspR9I	CCNGG	1 cut(s)	1023
MunI	CAATTG	1 cut(s)	510
Mva1269I	GAATGC	1 cut(s)	436
MwoI	GCNNNNNNNGC	1 cut(s)	561
NciI	CCSGG	1 cut(s)	1023
NdeII	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
NlaIII	CATG	7 cut(s)	83, 221, 245, 313, 547, 552, 851
NlaIV	GGNNCC	1 cut(s)	570
NmuCI	GTSAC	3 cut(s)	495, 883, 933
NsiI	ATGCAT	1 cut(s)	849
PaeR7I	CTCGAG	1 cut(s)	929
PagI	TCATGA	2 cut(s)	241, 309
PctI	GAATGC	1 cut(s)	436
PdmI	GAANNNNTTC	1 cut(s)	991
PfeI	GAWTC	5 cut(s)	186, 250, 376, 588, 914
PfoI	TCCNGGA	1 cut(s)	1021
PkrI	GCNGC	1 cut(s)	641
PleI	GAGTC	2 cut(s)	208, 940
PpsI	GAGTC	2 cut(s)	208, 940
PpuMI	RGGWCCY	1 cut(s)	568
PsiI	TTATAA	1 cut(s)	384
Psp124BI	GAGCTC	1 cut(s)	280
Psp5II	RGGWCCY	1 cut(s)	568
PspFI	CCCAGC	1 cut(s)	356
PspN4I	GGNNCC	1 cut(s)	570
PspPI	GGNCC	1 cut(s)	568
PspPPI	RGGWCCY	1 cut(s)	568
PsuI	RGATCY	2 cut(s)	516, 906
PvuII	CAGCTG	1 cut(s)	404
RseI	CAYNNNNRTG	1 cut(s)	603
SacI	GAGCTC	1 cut(s)	280
SaqAI	TTAA	3 cut(s)	758, 963, 1005
SatI	GCNGC	1 cut(s)	640
Sau3AI	GATC	8 cut(s)	82, 322, 370, 516, 652, 906, 940, 1028
Sau96I	GGNCC	1 cut(s)	568
SchI	GAGTC	2 cut(s)	209, 941
ScrFI	CCNGG	1 cut(s)	1023
SduI	GDGCHC	1 cut(s)	280
SfaNI	GCATC	2 cut(s)	701, 702
SfcI	CTRYAG	1 cut(s)	261
Sfr274I	CTCGAG	1 cut(s)	929
SinI	GGWCC	1 cut(s)	568
SlaI	CTCGAG	1 cut(s)	929
SmiMI	CAYNNNNRTG	1 cut(s)	603
SmlI	CTYRAG	2 cut(s)	721, 929
SmoI	CTYRAG	2 cut(s)	721, 929
Sse9I	AATT	7 cut(s)	46, 98, 129, 510, 700, 800, 964
SsiI	CCGC	2 cut(s)	483, 640
SspMI	CTAG	2 cut(s)	174, 503
SstI	GAGCTC	1 cut(s)	280
StyD4I	CCNGG	1 cut(s)	1021
StyI	CCWWGG	1 cut(s)	173
TaaI	ACNGT	2 cut(s)	318, 495
TaiI	ACGT	2 cut(s)	502, 720
TaqI	TCGA	3 cut(s)	591, 683, 930
TasI	AATT	7 cut(s)	46, 98, 129, 510, 700, 800, 964
TauI	GCSGC	1 cut(s)	642
TfiI	GAWTC	5 cut(s)	186, 250, 376, 588, 914
Tru1I	TTAA	3 cut(s)	758, 963, 1005
Tru9I	TTAA	3 cut(s)	758, 963, 1005
TscAI	CASTG	1 cut(s)	738
TseFI	GTSAC	3 cut(s)	495, 883, 933
Tsp45I	GTSAC	3 cut(s)	495, 883, 933
TspDTI	ATGAA	6 cut(s)	108, 178, 230, 326, 782, 831
TspGWI	ACGGA	2 cut(s)	476, 795
TspRI	CASTG	1 cut(s)	738
VpaK11BI	GGWCC	1 cut(s)	568
XapI	RAATTY	3 cut(s)	98, 700, 800
XhoI	CTCGAG	1 cut(s)	929
XmaJI	CCTAGG	1 cut(s)	173
XmiI	GTMKAC	1 cut(s)	73
XmnI	GAANNNNTTC	1 cut(s)	991
XspI	CTAG	2 cut(s)	174, 503
Zsp2I	ATGCAT	1 cut(s)	849

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.