Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6B

Orthogroup ID

OG0006429

Physical Location & Seq

Genomic Coordinates Forward (+)

42357047 .. 42363134

Gene Structure 6088 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6BG223900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGTCTCTAATTGATGTGAAACAAGCCCAAGTTCAAGGACTTACTGACAATTCCAAGAGGATTTTTGTGGGAGGTCTACCACATGATCTAAGAGATGAAGAATTCAAGAACTACTTTGAGAAGTTCGGTAAAATTACAGATTGGGATGTAATGTTTGATAAGGAAAACCACAAACCTAGGGGGTTTGGATTCATCACTTTTGAGTCAGAGGAGGCTGTGCATGATGTGTTTCAGAAGAGGTTTCATGAGTTCATGACTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

RRM_1

Protein Analysis

86

Amino Acids

10.23

Weight (kDa)

5.48

Isoelectric Point (pI)

38.94

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
RRM_7	PF16367	18 - 79	1e-10	RNA recognition motif
RRM_1	PF00076	21 - 78	2.4e-16	RNA recognition motif

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006429)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0015111 RchiOBHm_Chr6g0277551
rosa_laevigata	RLG00000013293 RLG00000032172
rosa_multiflora	Rmu_co8060368.1_g000001 Rmu_co8498617.1_g000001 Rmu_sc0001846.1_g000030 Rmu_sc0002209.1_g000005 Rmu_sc0002209.1_g000006 Rmu_sc0003910.1_g000002
rosa_roxburghii	Rroxscaffold_1G00061410 Rroxscaffold_1G00061420 Rroxscaffold_7G00191220
rosa_rugosa	Rorug05G0024500 Rorug05G0024500 Rorug06G0109600 Rorug06G0109600
rosa_samantha	Rh5AG118800 Rh5BG116700 Rh5BG116800 Rh5CG127800 Rh5DG115700 Rh6AG220000 Rh6BG223900 Rh6CG226200 Rh6DG216800
rosa_wichuraiana	Rw6G019260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	76
AcsI	RAATTY	1 cut(s)	101
AgsI	TTSAA	2 cut(s)	35, 106
Alw26I	GTCTC	1 cut(s)	9
ApoI	RAATTY	1 cut(s)	101
AspA2I	CCTAGG	1 cut(s)	176
AvrII	CCTAGG	1 cut(s)	176
BcoDI	GTCTC	1 cut(s)	9
BfaI	CTAG	1 cut(s)	177
BlnI	CCTAGG	1 cut(s)	176
BsaJI	CCNNGG	1 cut(s)	176
BseDI	CCNNGG	1 cut(s)	176
BseGI	GGATG	1 cut(s)	151
BseRI	GAGGAG	1 cut(s)	224
BsmAI	GTCTC	1 cut(s)	9
Bsp143I	GATC	1 cut(s)	85
BspHI	TCATGA	2 cut(s)	244, 252
BssECI	CCNNGG	1 cut(s)	176
BssMI	GATC	1 cut(s)	85
BssT1I	CCWWGG	1 cut(s)	176
Bst6I	CTCTTC	1 cut(s)	230
BstDEI	CTNAG	1 cut(s)	89
BstF5I	GGATG	1 cut(s)	151
BstKTI	GATC	1 cut(s)	88
BstMAI	GTCTC	1 cut(s)	9
BstMBI	GATC	1 cut(s)	85
BtsCI	GGATG	1 cut(s)	151
CciI	TCATGA	2 cut(s)	244, 252
CviAII	CATG	4 cut(s)	83, 221, 245, 253
CviJI	RGCY	2 cut(s)	26, 215
CviKI_1	RGCY	2 cut(s)	26, 215
DdeI	CTNAG	1 cut(s)	89
DpnI	GATC	1 cut(s)	87
DpnII	GATC	1 cut(s)	85
Eam1104I	CTCTTC	1 cut(s)	230
EarI	CTCTTC	1 cut(s)	230
Eco130I	CCWWGG	1 cut(s)	176
EcoRI	GAATTC	1 cut(s)	101
EcoT14I	CCWWGG	1 cut(s)	176
ErhI	CCWWGG	1 cut(s)	176
FaeI	CATG	4 cut(s)	86, 224, 248, 256
FaiI	YATR	4 cut(s)	84, 222, 246, 254
FalI	AAGNNNNNCTT	2 cut(s)	98, 130
FatI	CATG	4 cut(s)	82, 220, 244, 252
FblI	GTMKAC	1 cut(s)	76
FokI	GGATG	1 cut(s)	158
FspBI	CTAG	1 cut(s)	177
Hin1II	CATG	4 cut(s)	86, 224, 248, 256
HinfI	GANTC	2 cut(s)	189, 203
Hpy166II	GTNNAC	1 cut(s)	77
Hpy188I	TCNGA	2 cut(s)	208, 234
Hpy188III	TCNNGA	3 cut(s)	106, 245, 253
Hpy8I	GTNNAC	1 cut(s)	77
HpyCH4V	TGCA	1 cut(s)	220
HpyF3I	CTNAG	1 cut(s)	89
Hsp92II	CATG	4 cut(s)	86, 224, 248, 256
Kzo9I	GATC	1 cut(s)	85
MaeI	CTAG	1 cut(s)	177
MalI	GATC	1 cut(s)	87
MboI	GATC	1 cut(s)	85
MboII	GAAGA	2 cut(s)	110, 247
MluCI	AATT	4 cut(s)	9, 49, 101, 132
MlyI	GAGTC	1 cut(s)	212
MnlI	CCTC	5 cut(s)	51, 65, 202, 205, 231
NdeII	GATC	1 cut(s)	85
NlaIII	CATG	4 cut(s)	86, 224, 248, 256
PagI	TCATGA	2 cut(s)	244, 252
PfeI	GAWTC	1 cut(s)	189
PleI	GAGTC	1 cut(s)	211
PpsI	GAGTC	1 cut(s)	211
Sau3AI	GATC	1 cut(s)	85
SchI	GAGTC	1 cut(s)	212
SetI	ASST	3 cut(s)	76, 178, 242
SgeI	CNNG	9 cut(s)	35, 41, 47, 67, 95, 118, 189, 233, 257
Sse9I	AATT	4 cut(s)	9, 49, 101, 132
SspMI	CTAG	1 cut(s)	177
StyI	CCWWGG	1 cut(s)	176
TasI	AATT	4 cut(s)	9, 49, 101, 132
TfiI	GAWTC	1 cut(s)	189
TspDTI	ATGAA	4 cut(s)	111, 181, 233, 241
XapI	RAATTY	1 cut(s)	101
XmaJI	CCTAGG	1 cut(s)	176
XmiI	GTMKAC	1 cut(s)	76
XspI	CTAG	1 cut(s)	177

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.