Rroxscaffold_1G00061420

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
83565238 .. 83567174
1937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00061420.1

Sequence Viewer

Length: 168 bp
ATGGCGCATCAAAATCAACAGAAAGATGAAGAATTCCAGAACTACTTTGAGAATTTTGGTAAAATTACAGACTGGGTTGTAATGTATGATAGGGAAAACAACATGCCTAGGGGATTTGGATTCGTCACTTTTGATTCAGAGGAGGCTGTGGAGGATGTGTTGCGCTAG

Protein Analysis

55

Amino Acids

6.65

Weight (kDa)

4.3

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 8 - 54 1.4e-10 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 32, 52
ApoI RAATTY 2 cut(s) 32, 52
AspA2I CCTAGG 1 cut(s) 107
AspLEI GCGC 2 cut(s) 7, 165
AvrII CCTAGG 1 cut(s) 107
BfaI CTAG 2 cut(s) 108, 166
BlnI CCTAGG 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 16
BmuI ACTGGG 1 cut(s) 82
BsaJI CCNNGG 1 cut(s) 107
BsaXI ACNNNNNCTCC 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 107
BseGI GGATG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 77
BseRI GAGGAG 1 cut(s) 155
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 160
BstHHI GCGC 2 cut(s) 7, 165
BstNSI RCATGY 1 cut(s) 106
BtsCI GGATG 1 cut(s) 160
CfoI GCGC 2 cut(s) 7, 165
CviAII CATG 1 cut(s) 103
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
Eco130I CCWWGG 1 cut(s) 107
EcoRI GAATTC 1 cut(s) 32
EcoT14I CCWWGG 1 cut(s) 107
ErhI CCWWGG 1 cut(s) 107
FaeI CATG 1 cut(s) 106
FaiI YATR 2 cut(s) 87, 104
FatI CATG 1 cut(s) 102
FspBI CTAG 2 cut(s) 108, 166
GlaI GCGC 2 cut(s) 6, 164
HhaI GCGC 2 cut(s) 7, 165
Hin1II CATG 1 cut(s) 106
Hin6I GCGC 2 cut(s) 5, 163
HinP1I GCGC 2 cut(s) 5, 163
HinfI GANTC 2 cut(s) 120, 134
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 37
Hsp92II CATG 1 cut(s) 106
HspAI GCGC 2 cut(s) 5, 163
LpnPI CCDG 2 cut(s) 50, 58
LweI GCATC 1 cut(s) 16
MaeI CTAG 2 cut(s) 108, 166
MaeIII GTNAC 1 cut(s) 124
MboII GAAGA 1 cut(s) 41
MluCI AATT 3 cut(s) 32, 52, 63
MnlI CCTC 3 cut(s) 133, 136, 145
NlaIII CATG 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 124
NspI RCATGY 1 cut(s) 106
PfeI GAWTC 2 cut(s) 120, 134
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 4 cut(s) 49, 85, 115, 120
Sse9I AATT 3 cut(s) 32, 52, 63
SspMI CTAG 2 cut(s) 108, 166
StyI CCWWGG 1 cut(s) 107
TasI AATT 3 cut(s) 32, 52, 63
TfiI GAWTC 2 cut(s) 120, 134
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 42
XapI RAATTY 2 cut(s) 32, 52
XceI RCATGY 1 cut(s) 106
XmaJI CCTAGG 1 cut(s) 107
XspI CTAG 2 cut(s) 108, 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.