Rmu_co8091234.1_g000001

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8091234.1
Physical Location & Seq
Forward (+)
1 .. 376
376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8091234.1_g000001.1.cds

Sequence Viewer

Length: 376 bp
taaaggtgaatttgggggttgcaaagaggagagatcaagtggtgcatttatcttagttggtggggttagttgtgatttgagtaagaaattagaaggaggaggagttgagagtgatttgaaggtggagtctttgactctgaatgaggagaatgtagcccgagttgtcccggggaatgtcatgaatgtgagattttttccgagtactagtttgaggatggttgtggttgggaataaggctgggaatgttggattttggaatgttgattctaaggaaggggaggaaggtgggatatgtatgtatcacccacattctggtcccatttcggggatttctgttcaccaagattgcatgtcaaaggtaactttaatttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.12

Weight (kDa)

5.58

Isoelectric Point (pI)

47.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 312
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 1 cut(s) 203
AfiI CCNNNNNNNGG 3 cut(s) 312, 324, 325
AgsI TTSAA 1 cut(s) 119
AhlI ACTAGT 1 cut(s) 204
Ama87I CYCGRG 2 cut(s) 157, 167
ApoI RAATTY 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 315
AsuC2I CCSGG 2 cut(s) 168, 169
AsuHPI GGTGA 3 cut(s) 18, 294, 330
AvaI CYCGRG 2 cut(s) 157, 167
AvaII GGWCC 1 cut(s) 315
BccI CCATC 1 cut(s) 209
BcnI CCSGG 2 cut(s) 168, 169
BcuI ACTAGT 1 cut(s) 204
BfaI CTAG 1 cut(s) 205
BmcAI AGTACT 1 cut(s) 203
Bme1390I CCNGG 2 cut(s) 168, 169
Bme18I GGWCC 1 cut(s) 315
BmeT110I CYCGRG 2 cut(s) 157, 167
BmgT120I GGNCC 1 cut(s) 315
BmiI GGNNCC 1 cut(s) 317
BmrFI CCNGG 2 cut(s) 168, 169
BpuMI CCSGG 2 cut(s) 168, 169
BsaJI CCNNGG 2 cut(s) 167, 168
BsaXI ACNNNNNCTCC 2 cut(s) 88, 118
Bsc4I CCNNNNNNNGG 3 cut(s) 312, 324, 325
BseDI CCNNGG 2 cut(s) 167, 168
BseGI GGATG 1 cut(s) 220
BseLI CCNNNNNNNGG 3 cut(s) 312, 324, 325
BseRI GAGGAG 4 cut(s) 42, 112, 115, 159
BseYI CCCAGC 1 cut(s) 237
BsiHKCI CYCGRG 2 cut(s) 157, 167
BsiSI CCGG 1 cut(s) 168
BslFI GGGAC 2 cut(s) 150, 301
BslI CCNNNNNNNGG 3 cut(s) 312, 324, 325
BsmFI GGGAC 2 cut(s) 150, 301
BsoBI CYCGRG 2 cut(s) 157, 167
Bsp143I GATC 1 cut(s) 33
BspHI TCATGA 1 cut(s) 178
BspLI GGNNCC 1 cut(s) 317
BssECI CCNNGG 2 cut(s) 167, 168
BssMI GATC 1 cut(s) 33
BstDEI CTNAG 2 cut(s) 53, 268
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 1 cut(s) 36
BstMBI GATC 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 353
BstSCI CCNGG 2 cut(s) 166, 167
BtsCI GGATG 1 cut(s) 220
CciI TCATGA 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 315
Cfr9I CCCGGG 1 cut(s) 167
Csp6I GTAC 1 cut(s) 202
CviAII CATG 2 cut(s) 179, 350
CviJI RGCY 2 cut(s) 156, 237
CviKI_1 RGCY 2 cut(s) 156, 237
CviQI GTAC 1 cut(s) 202
DdeI CTNAG 2 cut(s) 53, 268
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 315
Eco88I CYCGRG 2 cut(s) 157, 167
FaeI CATG 2 cut(s) 182, 353
FaiI YATR 4 cut(s) 180, 293, 297, 351
FaqI GGGAC 2 cut(s) 150, 301
FatI CATG 2 cut(s) 178, 349
FokI GGATG 1 cut(s) 227
FspBI CTAG 1 cut(s) 205
GsaI CCCAGC 1 cut(s) 241
HapII CCGG 1 cut(s) 168
Hin1II CATG 2 cut(s) 182, 353
HinfI GANTC 3 cut(s) 126, 134, 264
HpaII CCGG 1 cut(s) 168
HphI GGTGA 3 cut(s) 18, 294, 330
Hpy166II GTNNAC 1 cut(s) 338
Hpy188I TCNGA 2 cut(s) 139, 199
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 338
HpyAV CCTTC 4 cut(s) 87, 113, 267, 276
HpyCH4V TGCA 3 cut(s) 22, 45, 349
HpyF3I CTNAG 2 cut(s) 53, 268
Hsp92II CATG 2 cut(s) 182, 353
Kzo9I GATC 1 cut(s) 33
LpnPI CCDG 3 cut(s) 181, 223, 298
MaeI CTAG 1 cut(s) 205
MaeIII GTNAC 1 cut(s) 359
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MluCI AATT 3 cut(s) 9, 87, 367
MlyI GAGTC 2 cut(s) 128, 135
MmeI TCCRAC 1 cut(s) 227
MnlI CCTC 6 cut(s) 20, 90, 93, 137, 205, 272
MseI TTAA 2 cut(s) 366, 374
MslI CAYNNNNRTG 1 cut(s) 183
MspI CCGG 1 cut(s) 168
MspR9I CCNGG 2 cut(s) 168, 169
NciI CCSGG 2 cut(s) 168, 169
NdeII GATC 1 cut(s) 33
NlaIII CATG 2 cut(s) 182, 353
NlaIV GGNNCC 1 cut(s) 317
NspI RCATGY 1 cut(s) 353
PagI TCATGA 1 cut(s) 178
PfeI GAWTC 1 cut(s) 264
PflMI CCANNNNNTGG 1 cut(s) 312
PleI GAGTC 2 cut(s) 128, 134
PpsI GAGTC 2 cut(s) 128, 134
PspFI CCCAGC 1 cut(s) 237
PspN4I GGNNCC 1 cut(s) 317
PspPI GGNCC 1 cut(s) 315
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
RseI CAYNNNNRTG 1 cut(s) 183
SaqAI TTAA 2 cut(s) 366, 374
Sau3AI GATC 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 315
ScaI AGTACT 1 cut(s) 203
SchI GAGTC 2 cut(s) 128, 135
ScrFI CCNGG 2 cut(s) 168, 169
SetI ASST 4 cut(s) 8, 124, 287, 361
SinI GGWCC 1 cut(s) 315
SmaI CCCGGG 1 cut(s) 169
SmiMI CAYNNNNRTG 1 cut(s) 183
SpeI ACTAGT 1 cut(s) 204
Sse9I AATT 3 cut(s) 9, 87, 367
SspMI CTAG 1 cut(s) 205
StyD4I CCNGG 2 cut(s) 166, 167
TasI AATT 3 cut(s) 9, 87, 367
TatI WGTACW 1 cut(s) 201
TfiI GAWTC 1 cut(s) 264
Tru1I TTAA 2 cut(s) 366, 374
Tru9I TTAA 2 cut(s) 366, 374
TspDTI ATGAA 1 cut(s) 195
TspMI CCCGGG 1 cut(s) 167
Van91I CCANNNNNTGG 1 cut(s) 312
VpaK11BI GGWCC 1 cut(s) 315
XapI RAATTY 1 cut(s) 9
XceI RCATGY 1 cut(s) 353
XmaI CCCGGG 1 cut(s) 167
XspI CTAG 1 cut(s) 205
ZrmI AGTACT 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.