Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8291973.1

Orthogroup ID

OG0005412

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 536

Gene Structure 536 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8291973.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 411 bp

atctttactagttgctatgatggatttatccgattgatggatgctgagaaagaggtgtttgatctagtatattcaagtggtgagactatatattctctcgctcaacagtcaaacaatgcaaagtgtttatactttgctgagggtcgtggaggtataagtatgtgggatgagagaacaggaaacatctcagcccaatggagtccgcatgatgatagaatcaattccatagactttaactcagaaaattcaaacatcatcaccactagttcaacagatggaactgcctgcatttgggatttgagatgtattgatgcagataaattcaaaagtttgaagacaattggccacaaaagggctgtgcattctgcctacttctcaccttctggaaggtcgctagtgacgacaaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

136

Amino Acids

15.22

Weight (kDa)

5.54

Isoelectric Point (pI)

43.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005412)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G80710
fragaria_vesca	FvH4_1g01460 FvH4_1g01460 FvH4_1g01460 FvH4_1g01460
malus_domestica	MD02G1011700.v1.1 MD15G1157400.v1.1
prunus_persica	Prupe.7G257900_v2.0.a1 Prupe.7G257900_v2.0.a1
pyrus_communis	pycom02g01070 pycom02g01100 pycom15g14110
rosa_chinensis	RchiOBHm_Chr2g0086391
rosa_laevigata	RLG00000015754
rosa_multiflora	Rmu_co8091234.1_g000001 Rmu_co8291973.1_g000001 Rmu_sc0005127.1_g000007 Rmu_sc0005127.1_g000009 Rmu_sc0041620.1_g000001
rosa_roxburghii	Rroxscaffold_2G00154620 Rroxscaffold_2G00154640
rosa_rugosa	Rorug01G0467000
rosa_samantha	Rh2AG017200 Rh2AG017500 Rh2BG017000 Rh2BG017200 Rh2CG018000 Rh2DG018700
rosa_wichuraiana	Rw2G001460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	203
AcoI	YGGCCR	1 cut(s)	343
AcsI	RAATTY	2 cut(s)	244, 320
AfiI	CCNNNNNNNGG	3 cut(s)	37, 291, 352
AgsI	TTSAA	5 cut(s)	75, 249, 270, 325, 334
AhlI	ACTAGT	2 cut(s)	8, 263
Alw26I	GTCTC	1 cut(s)	77
AoxI	GGCC	1 cut(s)	343
ApoI	RAATTY	2 cut(s)	244, 320
Asp700I	GAANNNNTTC	1 cut(s)	220
AsuHPI	GGTGA	3 cut(s)	92, 250, 369
BalI	TGGCCA	1 cut(s)	345
BbsI	GAAGAC	1 cut(s)	341
BbvCI	CCTCAGC	1 cut(s)	138
BccI	CCATC	3 cut(s)	14, 31, 269
BcoDI	GTCTC	1 cut(s)	77
BcuI	ACTAGT	2 cut(s)	8, 263
BfaI	CTAG	4 cut(s)	9, 65, 264, 395
BmsI	GCATC	2 cut(s)	31, 301
BpiI	GAAGAC	1 cut(s)	341
Bpu10I	CCTNAGC	1 cut(s)	138
Bsc4I	CCNNNNNNNGG	3 cut(s)	37, 291, 352
BseGI	GGATG	2 cut(s)	46, 172
BseLI	CCNNNNNNNGG	3 cut(s)	37, 291, 352
BseMII	CTCAG	4 cut(s)	36, 129, 201, 252
BshFI	GGCC	1 cut(s)	345
BslI	CCNNNNNNNGG	3 cut(s)	37, 291, 352
BsmAI	GTCTC	1 cut(s)	77
BsmI	GAATGC	1 cut(s)	361
BsnI	GGCC	1 cut(s)	345
Bsp143I	GATC	1 cut(s)	61
BspACI	CCGC	1 cut(s)	203
BspANI	GGCC	1 cut(s)	345
BspCNI	CTCAG	4 cut(s)	37, 130, 200, 251
BssMI	GATC	1 cut(s)	61
Bst4CI	ACNGT	1 cut(s)	108
BstC8I	GCNNGC	1 cut(s)	286
BstDEI	CTNAG	4 cut(s)	45, 138, 187, 238
BstF5I	GGATG	2 cut(s)	46, 172
BstKTI	GATC	1 cut(s)	64
BstMAI	GTCTC	1 cut(s)	77
BstMBI	GATC	1 cut(s)	61
BstV2I	GAAGAC	1 cut(s)	341
BsuRI	GGCC	1 cut(s)	345
BtsCI	GGATG	2 cut(s)	46, 172
Cac8I	GCNNGC	1 cut(s)	286
CviAII	CATG	1 cut(s)	206
CviJI	RGCY	3 cut(s)	191, 345, 356
CviKI_1	RGCY	3 cut(s)	191, 345, 356
DdeI	CTNAG	4 cut(s)	45, 138, 187, 238
DpnI	GATC	1 cut(s)	63
DpnII	GATC	1 cut(s)	61
EaeI	YGGCCR	1 cut(s)	343
FaeI	CATG	1 cut(s)	209
FaiI	YATR	9 cut(s)	18, 70, 89, 91, 130, 155, 161, 207, 227
FatI	CATG	1 cut(s)	205
FokI	GGATG	2 cut(s)	53, 179
FspBI	CTAG	4 cut(s)	9, 65, 264, 395
HaeIII	GGCC	1 cut(s)	345
Hin1II	CATG	1 cut(s)	209
HinfI	GANTC	2 cut(s)	199, 216
HphI	GGTGA	3 cut(s)	92, 250, 369
Hpy188I	TCNGA	2 cut(s)	32, 241
Hpy188III	TCNNGA	1 cut(s)	384
HpyAV	CCTTC	2 cut(s)	381, 390
HpyCH4III	ACNGT	1 cut(s)	108
HpyCH4V	TGCA	4 cut(s)	119, 288, 314, 361
HpyF3I	CTNAG	4 cut(s)	45, 138, 187, 238
Hsp92II	CATG	1 cut(s)	209
Kzo9I	GATC	1 cut(s)	61
LpnPI	CCDG	3 cut(s)	162, 298, 369
LweI	GCATC	2 cut(s)	31, 301
MaeI	CTAG	4 cut(s)	9, 65, 264, 395
MaeIII	GTNAC	1 cut(s)	397
MalI	GATC	1 cut(s)	63
MboI	GATC	1 cut(s)	61
MboII	GAAGA	1 cut(s)	346
MfeI	CAATTG	1 cut(s)	339
MlsI	TGGCCA	1 cut(s)	345
MluCI	AATT	4 cut(s)	220, 244, 320, 339
MluNI	TGGCCA	1 cut(s)	345
MlyI	GAGTC	1 cut(s)	208
MnlI	CCTC	3 cut(s)	46, 133, 143
Mox20I	TGGCCA	1 cut(s)	345
MroXI	GAANNNNTTC	1 cut(s)	220
MscI	TGGCCA	1 cut(s)	345
MseI	TTAA	1 cut(s)	234
Msp20I	TGGCCA	1 cut(s)	345
MunI	CAATTG	1 cut(s)	339
Mva1269I	GAATGC	1 cut(s)	361
NdeII	GATC	1 cut(s)	61
NlaIII	CATG	1 cut(s)	209
NmuCI	GTSAC	1 cut(s)	397
PcsI	WCGNNNNNNNCGW	1 cut(s)	398
PctI	GAATGC	1 cut(s)	361
PdmI	GAANNNNTTC	1 cut(s)	220
PfeI	GAWTC	1 cut(s)	216
PleI	GAGTC	1 cut(s)	207
PpsI	GAGTC	1 cut(s)	207
SaqAI	TTAA	1 cut(s)	234
Sau3AI	GATC	1 cut(s)	61
SchI	GAGTC	1 cut(s)	208
SetI	ASST	5 cut(s)	57, 154, 382, 392, 410
SfaNI	GCATC	2 cut(s)	31, 301
SpeI	ACTAGT	2 cut(s)	8, 263
Sse9I	AATT	4 cut(s)	220, 244, 320, 339
SsiI	CCGC	1 cut(s)	203
SspMI	CTAG	4 cut(s)	9, 65, 264, 395
TaaI	ACNGT	1 cut(s)	108
TasI	AATT	4 cut(s)	220, 244, 320, 339
TfiI	GAWTC	1 cut(s)	216
Tru1I	TTAA	1 cut(s)	234
Tru9I	TTAA	1 cut(s)	234
TseFI	GTSAC	1 cut(s)	397
Tsp45I	GTSAC	1 cut(s)	397
XapI	RAATTY	2 cut(s)	244, 320
XmnI	GAANNNNTTC	1 cut(s)	220
XspI	CTAG	4 cut(s)	9, 65, 264, 395

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.