Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005127.1

Orthogroup ID

OG0005412

Physical Location & Seq

Genomic Coordinates Reverse (-)

54960 .. 57189

Gene Structure 2230 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005127.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1131 bp

ctgattgaggccattttgggtgttgagaagaaaccccaattgggtttggaagataaaggtgaatttgggggttgcaaagaggagagatcaagtggtgcatttatcttagttggtggggttagttgtgatttgagtaagaaattagaaggaggaggagttgagagtgatttgaaggtggagtctttgactctgaatgaggagaatgtagcccgagttgtcccggggaatgtcatgaatgtgagattttttccgagtactagtttgaggatggttgtggttgggaataaggctgggaatgttggattttggaatgttgattctaaggaaggggaggaaggtgggatatgtatgtatcacccacattctggtcccatttcggggatttctgttcaccaagattgcatgtcaaagatctttactagttgctatgatggatttatccgattgatggatgctgagaaagaggtgtttgatctagtatattcaagtggtgagactatatattctctcgctcaacagtcaaacaatgcaaagtgtttatactttgctgagggtcgtggaggtataagtatgtgggatgagagaacaggaaacatctcagcccaatggagtccgcatgatgatagaatcaattccatagactttaactcagaaaattcaaacatcatcaccactagttcaacagatggaactgcctgcatttgggatttgagatgtattgatgcagataaattcaaaagtttgaagacaattggccacaaaagggctgtgcattctgcctacttctcaccttctggaaggtcgctagtgacgacaagtcttgatgacacagttggtatatcaagtggagttaattttgaggacatatcaaggatatcccatgacaataatacaggcagatggattcctaagttcaaggcaatatggggctgggatgatgcatatgtcttcatcggaaataagaatagaggaatcgatgtcatctcccaccttcaaaaaagagcagttttcactttaaagagcccatatatgtctgcaattccgtgtagattggctgctcacccttataatgttgggatgctagcaggagctacaggtggaggccaagtttatgtatggacattgggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

376

Amino Acids

41.0

Weight (kDa)

5.76

Isoelectric Point (pI)

41.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005412)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G80710
fragaria_vesca	FvH4_1g01460 FvH4_1g01460 FvH4_1g01460 FvH4_1g01460
malus_domestica	MD02G1011700.v1.1 MD15G1157400.v1.1
prunus_persica	Prupe.7G257900_v2.0.a1 Prupe.7G257900_v2.0.a1
pyrus_communis	pycom02g01070 pycom02g01100 pycom15g14110
rosa_chinensis	RchiOBHm_Chr2g0086391
rosa_laevigata	RLG00000015754
rosa_multiflora	Rmu_co8091234.1_g000001 Rmu_co8291973.1_g000001 Rmu_sc0005127.1_g000007 Rmu_sc0005127.1_g000009 Rmu_sc0041620.1_g000001
rosa_roxburghii	Rroxscaffold_2G00154620 Rroxscaffold_2G00154640
rosa_rugosa	Rorug01G0467000
rosa_samantha	Rh2AG017200 Rh2AG017500 Rh2BG017000 Rh2BG017200 Rh2CG018000 Rh2DG018700
rosa_wichuraiana	Rw2G001460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1068
AccB7I	CCANNNNNTGG	1 cut(s)	365
AciI	CCGC	1 cut(s)	614
AcoI	YGGCCR	1 cut(s)	754
AcsI	RAATTY	3 cut(s)	62, 655, 731
AfaI	GTAC	1 cut(s)	256
AfiI	CCNNNNNNNGG	7 cut(s)	41, 365, 377, 378, 448, 702, 763
AgsI	TTSAA	8 cut(s)	172, 486, 660, 681, 736, 745, 916, 995
AhdI	GACNNNNNGTC	1 cut(s)	816
AhlI	ACTAGT	3 cut(s)	257, 419, 674
AjuI	GAANNNNNNNTTGG	2 cut(s)	23, 55
AluBI	AGCT	1 cut(s)	1091
AluI	AGCT	1 cut(s)	1091
Alw26I	GTCTC	1 cut(s)	488
Ama87I	CYCGRG	2 cut(s)	210, 220
AoxI	GGCC	3 cut(s)	9, 754, 1102
ApeKI	GCWGC	1 cut(s)	1055
ApoI	RAATTY	3 cut(s)	62, 655, 731
Asp700I	GAANNNNTTC	1 cut(s)	631
AspS9I	GGNCC	1 cut(s)	368
AsuC2I	CCSGG	2 cut(s)	221, 222
AsuHPI	GGTGA	7 cut(s)	71, 347, 383, 503, 661, 780, 1052
AsuNHI	GCTAGC	1 cut(s)	1081
AvaI	CYCGRG	2 cut(s)	210, 220
AvaII	GGWCC	1 cut(s)	368
BalI	TGGCCA	1 cut(s)	756
BanII	GRGCYC	1 cut(s)	1025
BbsI	GAAGAC	2 cut(s)	752, 940
BbvCI	CCTCAGC	1 cut(s)	549
BbvI	GCAGC	1 cut(s)	1042
BccI	CCATC	5 cut(s)	262, 425, 442, 680, 894
BcnI	CCSGG	2 cut(s)	221, 222
BcoDI	GTCTC	1 cut(s)	488
BcuI	ACTAGT	3 cut(s)	257, 419, 674
BfaI	CTAG	6 cut(s)	258, 420, 476, 675, 806, 1082
BfmI	CTRYAG	1 cut(s)	1092
BglII	AGATCT	1 cut(s)	411
BisI	GCNGC	1 cut(s)	1056
BlsI	GCNGC	1 cut(s)	1057
BmcAI	AGTACT	1 cut(s)	256
Bme1390I	CCNGG	2 cut(s)	221, 222
Bme18I	GGWCC	1 cut(s)	368
BmeRI	GACNNNNNGTC	1 cut(s)	816
BmeT110I	CYCGRG	2 cut(s)	210, 220
BmgT120I	GGNCC	1 cut(s)	368
BmiI	GGNNCC	1 cut(s)	370
BmrFI	CCNGG	2 cut(s)	221, 222
BmsI	GCATC	4 cut(s)	442, 712, 928, 1068
BmtI	GCTAGC	1 cut(s)	1085
BpiI	GAAGAC	2 cut(s)	752, 940
Bpu10I	CCTNAGC	1 cut(s)	549
BpuMI	CCSGG	2 cut(s)	221, 222
Bsa29I	ATCGAT	1 cut(s)	975
BsaJI	CCNNGG	2 cut(s)	220, 221
BsaXI	ACNNNNNCTCC	4 cut(s)	141, 171, 1092, 1122
Bsc4I	CCNNNNNNNGG	7 cut(s)	41, 365, 377, 378, 448, 702, 763
BseCI	ATCGAT	1 cut(s)	975
BseDI	CCNNGG	2 cut(s)	220, 221
BseGI	GGATG	5 cut(s)	273, 457, 583, 940, 1083
BseLI	CCNNNNNNNGG	7 cut(s)	41, 365, 377, 378, 448, 702, 763
BseMII	CTCAG	4 cut(s)	447, 540, 612, 663
BseRI	GAGGAG	4 cut(s)	95, 165, 168, 212
BseXI	GCAGC	1 cut(s)	1042
BseYI	CCCAGC	2 cut(s)	290, 930
BshFI	GGCC	3 cut(s)	11, 756, 1104
BshVI	ATCGAT	1 cut(s)	975
BsiHKCI	CYCGRG	2 cut(s)	210, 220
BsiSI	CCGG	1 cut(s)	221
BslFI	GGGAC	2 cut(s)	203, 354
BslI	CCNNNNNNNGG	7 cut(s)	41, 365, 377, 378, 448, 702, 763
BsmAI	GTCTC	1 cut(s)	488
BsmFI	GGGAC	2 cut(s)	203, 354
BsmI	GAATGC	1 cut(s)	772
BsnI	GGCC	3 cut(s)	11, 756, 1104
BsoBI	CYCGRG	2 cut(s)	210, 220
Bsp1286I	GDGCHC	1 cut(s)	1025
Bsp143I	GATC	3 cut(s)	86, 411, 472
BspACI	CCGC	1 cut(s)	614
BspANI	GGCC	3 cut(s)	11, 756, 1104
BspCNI	CTCAG	4 cut(s)	448, 541, 611, 662
BspDI	ATCGAT	1 cut(s)	975
BspHI	TCATGA	1 cut(s)	231
BspLI	GGNNCC	1 cut(s)	370
BspOI	GCTAGC	1 cut(s)	1085
BssECI	CCNNGG	2 cut(s)	220, 221
BssMI	GATC	3 cut(s)	86, 411, 472
Bst4CI	ACNGT	2 cut(s)	519, 832
BstC8I	GCNNGC	2 cut(s)	697, 1083
BstDEI	CTNAG	7 cut(s)	106, 321, 456, 549, 598, 649, 909
BstF5I	GGATG	5 cut(s)	273, 457, 583, 940, 1083
BstKTI	GATC	3 cut(s)	89, 414, 475
BstMAI	GTCTC	1 cut(s)	488
BstMBI	GATC	3 cut(s)	86, 411, 472
BstNSI	RCATGY	1 cut(s)	406
BstSCI	CCNGG	2 cut(s)	219, 220
BstSFI	CTRYAG	1 cut(s)	1092
BstV1I	GCAGC	1 cut(s)	1042
BstV2I	GAAGAC	2 cut(s)	752, 940
BstX2I	RGATCY	1 cut(s)	411
BstYI	RGATCY	1 cut(s)	411
Bsu15I	ATCGAT	1 cut(s)	975
BsuRI	GGCC	3 cut(s)	11, 756, 1104
BsuTUI	ATCGAT	1 cut(s)	975
BtsCI	GGATG	5 cut(s)	273, 457, 583, 940, 1083
Cac8I	GCNNGC	2 cut(s)	697, 1083
CciI	TCATGA	1 cut(s)	231
Cfr13I	GGNCC	1 cut(s)	368
Cfr9I	CCCGGG	1 cut(s)	220
ClaI	ATCGAT	1 cut(s)	975
Csp6I	GTAC	1 cut(s)	255
CviAII	CATG	4 cut(s)	232, 403, 617, 881
CviQI	GTAC	1 cut(s)	255
DdeI	CTNAG	7 cut(s)	106, 321, 456, 549, 598, 649, 909
DpnI	GATC	3 cut(s)	88, 413, 474
DpnII	GATC	3 cut(s)	86, 411, 472
DraI	TTTAAA	1 cut(s)	1017
DriI	GACNNNNNGTC	1 cut(s)	816
EaeI	YGGCCR	1 cut(s)	754
Eam1105I	GACNNNNNGTC	1 cut(s)	816
Eco24I	GRGCYC	1 cut(s)	1025
Eco32I	GATATC	1 cut(s)	876
Eco47I	GGWCC	1 cut(s)	368
Eco88I	CYCGRG	2 cut(s)	210, 220
EcoRV	GATATC	1 cut(s)	876
EcoT22I	ATGCAT	1 cut(s)	943
EcoT38I	GRGCYC	1 cut(s)	1025
FaeI	CATG	4 cut(s)	235, 406, 620, 884
FaqI	GGGAC	2 cut(s)	203, 354
FatI	CATG	4 cut(s)	231, 402, 616, 880
FauNDI	CATATG	1 cut(s)	943
Fnu4HI	GCNGC	1 cut(s)	1056
FokI	GGATG	5 cut(s)	280, 464, 590, 947, 1090
FriOI	GRGCYC	1 cut(s)	1025
Fsp4HI	GCNGC	1 cut(s)	1056
FspBI	CTAG	6 cut(s)	258, 420, 476, 675, 806, 1082
GluI	GCNGC	1 cut(s)	1056
GsaI	CCCAGC	2 cut(s)	294, 934
HaeIII	GGCC	3 cut(s)	11, 756, 1104
HapII	CCGG	1 cut(s)	221
Hin1II	CATG	4 cut(s)	235, 406, 620, 884
HinfI	GANTC	7 cut(s)	179, 187, 317, 610, 627, 904, 972
HpaII	CCGG	1 cut(s)	221
HphI	GGTGA	7 cut(s)	71, 347, 383, 503, 661, 780, 1052
Hpy166II	GTNNAC	1 cut(s)	391
Hpy188I	TCNGA	5 cut(s)	192, 252, 443, 652, 956
Hpy188III	TCNNGA	3 cut(s)	232, 795, 821
Hpy8I	GTNNAC	1 cut(s)	391
HpyAV	CCTTC	7 cut(s)	140, 166, 320, 329, 792, 801, 1001
HpyCH4III	ACNGT	2 cut(s)	519, 832
HpyCH4V	TGCA	9 cut(s)	75, 98, 402, 530, 699, 725, 772, 941, 1037
HpyF3I	CTNAG	7 cut(s)	106, 321, 456, 549, 598, 649, 909
Hsp92II	CATG	4 cut(s)	235, 406, 620, 884
Kzo9I	GATC	3 cut(s)	86, 411, 472
LmnI	GCTCC	1 cut(s)	1088
Lsp1109I	GCAGC	1 cut(s)	1042
LweI	GCATC	4 cut(s)	442, 712, 928, 1068
MaeI	CTAG	6 cut(s)	258, 420, 476, 675, 806, 1082
MaeIII	GTNAC	1 cut(s)	808
MalI	GATC	3 cut(s)	88, 413, 474
MboI	GATC	3 cut(s)	86, 411, 472
MboII	GAAGA	4 cut(s)	40, 62, 757, 940
MfeI	CAATTG	2 cut(s)	38, 750
MflI	RGATCY	1 cut(s)	411
MhlI	GDGCHC	1 cut(s)	1025
MlsI	TGGCCA	1 cut(s)	756
MluCI	AATT	9 cut(s)	38, 62, 140, 631, 655, 731, 750, 853, 1038
MluNI	TGGCCA	1 cut(s)	756
MlyI	GAGTC	3 cut(s)	181, 188, 619
MmeI	TCCRAC	1 cut(s)	280
Mox20I	TGGCCA	1 cut(s)	756
Mph1103I	ATGCAT	1 cut(s)	943
MroXI	GAANNNNTTC	1 cut(s)	631
MscI	TGGCCA	1 cut(s)	756
MseI	TTAA	3 cut(s)	645, 852, 1016
MslI	CAYNNNNRTG	1 cut(s)	236
Msp20I	TGGCCA	1 cut(s)	756
MspI	CCGG	1 cut(s)	221
MspR9I	CCNGG	2 cut(s)	221, 222
MunI	CAATTG	2 cut(s)	38, 750
Mva1269I	GAATGC	1 cut(s)	772
NciI	CCSGG	2 cut(s)	221, 222
NdeI	CATATG	1 cut(s)	943
NdeII	GATC	3 cut(s)	86, 411, 472
NheI	GCTAGC	1 cut(s)	1081
NlaIII	CATG	4 cut(s)	235, 406, 620, 884
NlaIV	GGNNCC	1 cut(s)	370
NmuCI	GTSAC	1 cut(s)	808
NsiI	ATGCAT	1 cut(s)	943
NspI	RCATGY	1 cut(s)	406
PagI	TCATGA	1 cut(s)	231
PcsI	WCGNNNNNNNCGW	1 cut(s)	809
PctI	GAATGC	1 cut(s)	772
PdmI	GAANNNNTTC	1 cut(s)	631
PfeI	GAWTC	4 cut(s)	317, 627, 904, 972
PflMI	CCANNNNNTGG	1 cut(s)	365
PkrI	GCNGC	1 cut(s)	1057
PleI	GAGTC	3 cut(s)	181, 187, 618
PpsI	GAGTC	3 cut(s)	181, 187, 618
PsiI	TTATAA	1 cut(s)	1068
PspFI	CCCAGC	2 cut(s)	290, 930
PspN4I	GGNNCC	1 cut(s)	370
PspPI	GGNCC	1 cut(s)	368
PsuI	RGATCY	1 cut(s)	411
RsaI	GTAC	1 cut(s)	256
RsaNI	GTAC	1 cut(s)	255
RseI	CAYNNNNRTG	1 cut(s)	236
SaqAI	TTAA	3 cut(s)	645, 852, 1016
SatI	GCNGC	1 cut(s)	1056
Sau3AI	GATC	3 cut(s)	86, 411, 472
Sau96I	GGNCC	1 cut(s)	368
ScaI	AGTACT	1 cut(s)	256
SchI	GAGTC	3 cut(s)	181, 188, 619
ScrFI	CCNGG	2 cut(s)	221, 222
SduI	GDGCHC	1 cut(s)	1025
SfaNI	GCATC	4 cut(s)	442, 712, 928, 1068
SfcI	CTRYAG	1 cut(s)	1092
SinI	GGWCC	1 cut(s)	368
SmaI	CCCGGG	1 cut(s)	222
SmiMI	CAYNNNNRTG	1 cut(s)	236
SpeI	ACTAGT	3 cut(s)	257, 419, 674
Sse9I	AATT	9 cut(s)	38, 62, 140, 631, 655, 731, 750, 853, 1038
SsiI	CCGC	1 cut(s)	614
SspMI	CTAG	6 cut(s)	258, 420, 476, 675, 806, 1082
StyD4I	CCNGG	2 cut(s)	219, 220
TaaI	ACNGT	2 cut(s)	519, 832
TaqI	TCGA	1 cut(s)	975
TasI	AATT	9 cut(s)	38, 62, 140, 631, 655, 731, 750, 853, 1038
TatI	WGTACW	1 cut(s)	254
TfiI	GAWTC	4 cut(s)	317, 627, 904, 972
Tru1I	TTAA	3 cut(s)	645, 852, 1016
Tru9I	TTAA	3 cut(s)	645, 852, 1016
TseFI	GTSAC	1 cut(s)	808
TseI	GCWGC	1 cut(s)	1055
Tsp45I	GTSAC	1 cut(s)	808
TspDTI	ATGAA	2 cut(s)	248, 940
TspGWI	ACGGA	1 cut(s)	1032
TspMI	CCCGGG	1 cut(s)	220
Van91I	CCANNNNNTGG	1 cut(s)	365
VpaK11BI	GGWCC	1 cut(s)	368
XapI	RAATTY	3 cut(s)	62, 655, 731
XceI	RCATGY	1 cut(s)	406
XmaI	CCCGGG	1 cut(s)	220
XmnI	GAANNNNTTC	1 cut(s)	631
XspI	CTAG	6 cut(s)	258, 420, 476, 675, 806, 1082
ZrmI	AGTACT	1 cut(s)	256
Zsp2I	ATGCAT	1 cut(s)	943

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.