Rmu_co8092630.1_g000001

Protein of unknown function (DUF3741)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8092630.1
Physical Location & Seq
Reverse (-)
2 .. 383
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8092630.1_g000001.1.cds

Sequence Viewer

Length: 382 bp
atgactcatatgtcccaggaagtgggagtggctagcaggggcagcacacttgctgaaatgcttgctatcccagacaaggaaacgcaagccgcaaaactggatgccatgaaaggtgaggcaggattcagagataaatttgcaagagaagatggacctgtagggtggggtggacctcttggtatcagcagtagggatggctggaaggatggatgcatcgcaagtttatcaagatcgaaatctctccctgcttcttctagtgcatttgggagttataagacaagtatgcgccgggaaaccatacgtgatgacaggtatctgataccagccgaggcattcaagcataaaagaaaccaatcagtagttgattttgaccatagagaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

13.94

Weight (kDa)

8.79

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 273
AasI GACNNNNNNGTC 1 cut(s) 10
AccB7I CCANNNNNTGG 1 cut(s) 22
AciI CCGC 1 cut(s) 90
AcsI RAATTY 1 cut(s) 134
AfiI CCNNNNNNNGG 2 cut(s) 22, 76
AgsI TTSAA 1 cut(s) 337
AjnI CCWGG 1 cut(s) 15
ApeKI GCWGC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 134
AspLEI GCGC 1 cut(s) 288
AspS9I GGNCC 2 cut(s) 152, 170
AsuC2I CCSGG 1 cut(s) 290
AsuHPI GGTGA 1 cut(s) 125
AsuNHI GCTAGC 1 cut(s) 32
AvaII GGWCC 2 cut(s) 152, 170
BbvI GCAGC 1 cut(s) 54
BccI CCATC 3 cut(s) 143, 188, 200
BciT130I CCWGG 1 cut(s) 17
BcnI CCSGG 1 cut(s) 290
BfaI CTAG 2 cut(s) 33, 255
BfmI CTRYAG 1 cut(s) 156
BisI GCNGC 2 cut(s) 43, 90
BlsI GCNGC 2 cut(s) 44, 91
Bme1390I CCNGG 2 cut(s) 17, 290
Bme18I GGWCC 2 cut(s) 152, 170
BmgT120I GGNCC 2 cut(s) 152, 170
BmrFI CCNGG 2 cut(s) 17, 290
BmsI GCATC 3 cut(s) 91, 200, 222
BmtI GCTAGC 1 cut(s) 36
BpuMI CCSGG 1 cut(s) 290
BsaAI YACGTR 1 cut(s) 302
BsaBI GATNNNNATC 1 cut(s) 235
BsaJI CCNNGG 2 cut(s) 15, 327
Bsc4I CCNNNNNNNGG 2 cut(s) 22, 76
Bse1I ACTGG 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 235
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 2 cut(s) 15, 327
BseGI GGATG 4 cut(s) 106, 199, 211, 215
BseJI GATNNNNATC 1 cut(s) 235
BseLI CCNNNNNNNGG 2 cut(s) 22, 76
BseNI ACTGG 1 cut(s) 102
BseXI GCAGC 1 cut(s) 54
BsiSI CCGG 1 cut(s) 289
BslI CCNNNNNNNGG 2 cut(s) 22, 76
BsmI GAATGC 1 cut(s) 332
Bsp143I GATC 1 cut(s) 230
BspACI CCGC 1 cut(s) 90
BspOI GCTAGC 1 cut(s) 36
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 15, 327
BssMI GATC 1 cut(s) 230
Bst2UI CCWGG 1 cut(s) 17
BstBAI YACGTR 1 cut(s) 302
BstC8I GCNNGC 3 cut(s) 34, 63, 87
BstF5I GGATG 4 cut(s) 106, 199, 211, 215
BstHHI GCGC 1 cut(s) 288
BstKTI GATC 1 cut(s) 233
BstMBI GATC 1 cut(s) 230
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 17
BstSCI CCNGG 2 cut(s) 15, 288
BstSFI CTRYAG 1 cut(s) 156
BstV1I GCAGC 1 cut(s) 54
BtgZI GCGATG 1 cut(s) 199
BtsCI GGATG 4 cut(s) 106, 199, 211, 215
Cac8I GCNNGC 3 cut(s) 34, 63, 87
CfoI GCGC 1 cut(s) 288
Cfr13I GGNCC 2 cut(s) 152, 170
CviAII CATG 1 cut(s) 106
CviJI RGCY 4 cut(s) 32, 89, 198, 326
CviKI_1 RGCY 4 cut(s) 32, 89, 198, 326
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
DrdI GACNNNNNNGTC 1 cut(s) 10
DseDI GACNNNNNNGTC 1 cut(s) 10
Eco47I GGWCC 2 cut(s) 152, 170
EcoRII CCWGG 1 cut(s) 15
EcoT22I ATGCAT 1 cut(s) 215
FaeI CATG 1 cut(s) 109
FaiI YATR 8 cut(s) 9, 11, 107, 273, 284, 299, 342, 375
FatI CATG 1 cut(s) 105
FauNDI CATATG 1 cut(s) 9
Fnu4HI GCNGC 2 cut(s) 43, 90
FokI GGATG 4 cut(s) 113, 206, 218, 222
Fsp4HI GCNGC 2 cut(s) 43, 90
FspBI CTAG 2 cut(s) 33, 255
GlaI GCGC 1 cut(s) 287
GluI GCNGC 2 cut(s) 43, 90
HapII CCGG 1 cut(s) 289
HhaI GCGC 1 cut(s) 288
Hin1II CATG 1 cut(s) 109
Hin6I GCGC 1 cut(s) 286
HinP1I GCGC 1 cut(s) 286
HinfI GANTC 2 cut(s) 4, 123
HpaII CCGG 1 cut(s) 289
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 128, 318
Hpy188III TCNNGA 1 cut(s) 228
Hpy8I GTNNAC 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 196
HpyCH4IV ACGT 1 cut(s) 301
HpyCH4V TGCA 3 cut(s) 140, 213, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 301
Hsp92II CATG 1 cut(s) 109
HspAI GCGC 1 cut(s) 286
Kzo9I GATC 1 cut(s) 230
Lsp1109I GCAGC 1 cut(s) 54
LweI GCATC 3 cut(s) 91, 200, 222
MaeI CTAG 2 cut(s) 33, 255
MaeII ACGT 1 cut(s) 301
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MboII GAAGA 2 cut(s) 158, 243
MluCI AATT 1 cut(s) 134
MnlI CCTC 3 cut(s) 109, 183, 322
Mph1103I ATGCAT 1 cut(s) 215
MspI CCGG 1 cut(s) 289
MspR9I CCNGG 2 cut(s) 17, 290
Mva1269I GAATGC 1 cut(s) 332
MvaI CCWGG 1 cut(s) 17
MwoI GCNNNNNNNGC 1 cut(s) 42
NciI CCSGG 1 cut(s) 290
NdeI CATATG 1 cut(s) 9
NdeII GATC 1 cut(s) 230
NheI GCTAGC 1 cut(s) 32
NlaIII CATG 1 cut(s) 109
NmeAIII GCCGAG 1 cut(s) 352
NsiI ATGCAT 1 cut(s) 215
PctI GAATGC 1 cut(s) 332
PfeI GAWTC 1 cut(s) 123
PflMI CCANNNNNTGG 1 cut(s) 22
PkrI GCNGC 2 cut(s) 44, 91
Ppu21I YACGTR 1 cut(s) 302
PsiI TTATAA 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
PspPI GGNCC 2 cut(s) 152, 170
SatI GCNGC 2 cut(s) 43, 90
Sau3AI GATC 1 cut(s) 230
Sau96I GGNCC 2 cut(s) 152, 170
ScrFI CCNGG 2 cut(s) 17, 290
SetI ASST 5 cut(s) 115, 157, 175, 304, 314
SfaNI GCATC 3 cut(s) 91, 200, 222
SfcI CTRYAG 1 cut(s) 156
SinI GGWCC 2 cut(s) 152, 170
Sse9I AATT 1 cut(s) 134
SsiI CCGC 1 cut(s) 90
SspMI CTAG 2 cut(s) 33, 255
StyD4I CCNGG 2 cut(s) 15, 288
TaiI ACGT 1 cut(s) 304
TaqI TCGA 1 cut(s) 233
TasI AATT 1 cut(s) 134
TauI GCSGC 1 cut(s) 92
TfiI GAWTC 1 cut(s) 123
TseI GCWGC 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 122
Van91I CCANNNNNTGG 1 cut(s) 22
VpaK11BI GGWCC 2 cut(s) 152, 170
XapI RAATTY 1 cut(s) 134
XspI CTAG 2 cut(s) 33, 255
Zsp2I ATGCAT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.