Rmu_co8117600.1_g000001

Ubiquitin associated domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8117600.1
Physical Location & Seq
Forward (+)
225 .. 500
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8117600.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
atgtctccagcgtctccgaatggtagctggtcttgtgagtcggaagaacatcaacacaaaacatctagtcctcccgttaagccagagacagtaccgggaactgacaatgacaacagccagcaaactcaagagttgcatgaacgatgtcgtggttttcttatgtcgacaaaattgagggcacttgctcaacagatgacggcgattggttttacgctagaactggcaacagaggctctcatttgcaatgaaggcagtgttgagaaatcagtagcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

9.89

Weight (kDa)

5.03

Isoelectric Point (pI)

65.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 164
AfaI GTAC 1 cut(s) 93
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw26I GTCTC 3 cut(s) 9, 18, 80
AsuC2I CCSGG 1 cut(s) 96
BaeGI GKGCMC 1 cut(s) 181
BceAI ACGGC 1 cut(s) 213
BcnI CCSGG 1 cut(s) 96
BcoDI GTCTC 3 cut(s) 9, 18, 80
BfaI CTAG 2 cut(s) 66, 215
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 111
BpuMI CCSGG 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 225
Bse3DI GCAATG 1 cut(s) 250
BseMI GCAATG 1 cut(s) 250
BseNI ACTGG 1 cut(s) 225
BseSI GKGCMC 1 cut(s) 181
BsiSI CCGG 1 cut(s) 95
BsmAI GTCTC 3 cut(s) 9, 18, 80
BsmBI CGTCTC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 181
BsrDI GCAATG 1 cut(s) 250
BsrI ACTGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 119
BstMAI GTCTC 3 cut(s) 9, 18, 80
BstMWI GCNNNNNNNGC 2 cut(s) 230, 249
BstSCI CCNGG 1 cut(s) 94
BstSLI GKGCMC 1 cut(s) 181
BtsI GCAGTG 1 cut(s) 259
BtsIMutI CAGTG 1 cut(s) 259
Cac8I GCNNGC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 92
CviAII CATG 2 cut(s) 137, 273
CviJI RGCY 4 cut(s) 27, 82, 117, 233
CviKI_1 RGCY 4 cut(s) 27, 82, 117, 233
CviQI GTAC 1 cut(s) 92
Esp3I CGTCTC 1 cut(s) 18
FaeI CATG 2 cut(s) 140, 276
FaiI YATR 3 cut(s) 138, 161, 274
FatI CATG 2 cut(s) 136, 272
FblI GTMKAC 1 cut(s) 164
FspBI CTAG 2 cut(s) 66, 215
HapII CCGG 1 cut(s) 95
Hin1II CATG 2 cut(s) 140, 276
HincII GTYRAC 1 cut(s) 165
HindII GTYRAC 1 cut(s) 165
HinfI GANTC 1 cut(s) 38
HpaII CCGG 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 165
Hpy188I TCNGA 2 cut(s) 18, 43
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 242
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 2 cut(s) 136, 243
HpyF10VI GCNNNNNNNGC 2 cut(s) 230, 249
Hsp92II CATG 2 cut(s) 140, 276
LpnPI CCDG 6 cut(s) 13, 21, 96, 108, 131, 206
MaeI CTAG 2 cut(s) 66, 215
MboII GAAGA 1 cut(s) 56
MhlI GDGCHC 1 cut(s) 181
MluCI AATT 1 cut(s) 170
MlyI GAGTC 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 3 cut(s) 81, 168, 223
MseI TTAA 1 cut(s) 78
MspI CCGG 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 230, 249
NciI CCSGG 1 cut(s) 96
NlaIII CATG 2 cut(s) 140, 276
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
RsaI GTAC 1 cut(s) 93
RsaNI GTAC 1 cut(s) 92
SalI GTCGAC 1 cut(s) 163
SaqAI TTAA 1 cut(s) 78
SchI GAGTC 1 cut(s) 47
ScrFI CCNGG 1 cut(s) 96
SduI GDGCHC 1 cut(s) 181
SetI ASST 1 cut(s) 29
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
Sse9I AATT 1 cut(s) 170
SspMI CTAG 2 cut(s) 66, 215
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 91
TaqI TCGA 1 cut(s) 164
TasI AATT 1 cut(s) 170
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 1 cut(s) 259
TspDTI ATGAA 2 cut(s) 153, 261
TspRI CASTG 1 cut(s) 259
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 2 cut(s) 66, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.