Rmu_co8216896.1_g000001

Plant protein of unknown function (DUF641)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8216896.1
Physical Location & Seq
Reverse (-)
1 .. 713
713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8216896.1_g000001.1.cds

Sequence Viewer

Length: 198 bp
atgtggttgcttcacttgctggcgttctcgcttgaccctgcaccaagtcagtttgaggctggcagaggagctgattttcatccagactacatggagagtgttctcaagtctccaggacaagttccttcgggtcaagttgttgggtttcccttaattccagggttcaagcttggcaatgagtcgattattaaggccaga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.17

Weight (kDa)

6.0

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 2 cut(s) 112, 157
AluBI AGCT 2 cut(s) 71, 169
AluI AGCT 2 cut(s) 71, 169
Alw26I GTCTC 1 cut(s) 114
AoxI GGCC 1 cut(s) 192
BciT130I CCWGG 2 cut(s) 114, 159
BcoDI GTCTC 1 cut(s) 114
Bme1390I CCNGG 2 cut(s) 114, 159
BmrFI CCNGG 2 cut(s) 114, 159
BpmI CTGGAG 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 89
BsaBI GATNNNNATC 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 181
Bse8I GATNNNNATC 1 cut(s) 78
BseBI CCWGG 2 cut(s) 114, 159
BseDI CCNNGG 1 cut(s) 158
BseGI GGATG 1 cut(s) 79
BseJI GATNNNNATC 1 cut(s) 78
BseMI GCAATG 1 cut(s) 181
BseRI GAGGAG 1 cut(s) 81
BsgI GTGCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 114
BsnI GGCC 1 cut(s) 194
BspANI GGCC 1 cut(s) 194
BsrDI GCAATG 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 158
Bst2UI CCWGG 2 cut(s) 114, 159
BstC8I GCNNGC 2 cut(s) 21, 61
BstF5I GGATG 1 cut(s) 79
BstMAI GTCTC 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstNI CCWGG 2 cut(s) 114, 159
BstSCI CCNGG 2 cut(s) 112, 157
BsuRI GGCC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 79
Cac8I GCNNGC 2 cut(s) 21, 61
CviAII CATG 1 cut(s) 91
CviJI RGCY 4 cut(s) 59, 71, 169, 194
CviKI_1 RGCY 4 cut(s) 59, 71, 169, 194
EcoRII CCWGG 2 cut(s) 112, 157
FaeI CATG 1 cut(s) 94
FaiI YATR 1 cut(s) 92
FatI CATG 1 cut(s) 90
FokI GGATG 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 194
Hin1II CATG 1 cut(s) 94
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 83
HpyAV CCTTC 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
Hsp92II CATG 1 cut(s) 94
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 8 cut(s) 5, 45, 51, 96, 99, 126, 144, 171
MluCI AATT 1 cut(s) 153
MlyI GAGTC 1 cut(s) 188
MnlI CCTC 2 cut(s) 49, 59
MseI TTAA 2 cut(s) 152, 189
MspR9I CCNGG 2 cut(s) 114, 159
MvaI CCWGG 2 cut(s) 114, 159
MwoI GCNNNNNNNGC 1 cut(s) 16
NlaIII CATG 1 cut(s) 94
PfoI TCCNGGA 1 cut(s) 112
PleI GAGTC 1 cut(s) 187
PpsI GAGTC 1 cut(s) 187
Psp6I CCWGG 2 cut(s) 112, 157
PspGI CCWGG 2 cut(s) 112, 157
SaqAI TTAA 2 cut(s) 152, 189
SchI GAGTC 1 cut(s) 188
ScrFI CCNGG 2 cut(s) 114, 159
SetI ASST 2 cut(s) 73, 171
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 153
StyD4I CCNGG 2 cut(s) 112, 157
TaqI TCGA 1 cut(s) 182
TasI AATT 1 cut(s) 153
Tru1I TTAA 2 cut(s) 152, 189
Tru9I TTAA 2 cut(s) 152, 189
TspDTI ATGAA 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.