Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000005

Orthogroup ID

OG0002215

Physical Location & Seq

Genomic Coordinates Reverse (-)

52649911 .. 52652200

Gene Structure 2290 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug05G0387600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

ATGGAGGCCATCTACTTTGATGAAGGTGTAAGGAACTCAAGACGACACCAATTGAAAACAAGAGCATTGGATGAGCTATGTAATGGCAGTGACATTGATAAGCGCACAGCTACTAGCATGAGCAGAAAGCAATTCTATGGAGAAGGATGGCTTGATGGTGAATGCAACTGGGTTAAATACTTCAAATACAGGTTTGTTCGCATTTGCTTCTTCAACAGACATGACGACTGCAACTTGACCCACCTGGGCTCCTGCAAAAGATGGACCACATGCAGGGAGATGTGGTTTCTGCTTTTCAAAGTAAAAGAAACAGCTTTTTCGATATTGAGGTGCTCCTACAGATTAGGACCACATGCAGAGAGATGTGGTTTCTGCTTTTCAAAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009314 GO:0009416 GO:0009605 GO:0009606 GO:0009628 GO:0009629 GO:0009630 GO:0009639 GO:0009959 GO:0050896

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF641

Protein Analysis

128

Amino Acids

15.37

Weight (kDa)

9.15

Isoelectric Point (pI)

36.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002215)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G58960 AT5G58960 AT5G58960
fragaria_vesca	FvH4_3g37820 FvH4_3g37850
malus_domestica	MD03G1078100.v1.1 MD11G1082800.v1.1
prunus_persica	Prupe.6G063100_v2.0.a1
pyrus_communis	pycom03g06240 pycom11g07090
rosa_chinensis	RchiOBHm_Chr5g0068001 RchiOBHm_Chr5g0068051 RchiOBHm_Chr5g0068071
rosa_laevigata	RLG00000035951 RLG00000035952
rosa_multiflora	Rmu_co8216896.1_g000001 Rmu_co8424771.1_g000001 Rmu_sc0000435.1_g000019 Rmu_sc0000435.1_g000025 Rmu_sc0000435.1_g000034
rosa_roxburghii	Rroxscaffold_1G00012550 Rroxscaffold_1G00012560 Rroxscaffold_1G00013280 Rroxscaffold_1G00013290
rosa_rugosa	Rorug05G0387200 Rorug05G0387600 Rorug05G0388100
rosa_samantha	Rh5AG446100 Rh5AG446300 Rh5AG446400 Rh5BG463600 Rh5BG464000 Rh5BG464300 Rh5CG485500 Rh5CG486000 Rh5CG486300 Rh5DG477600 Rh5DG478000 Rh5DG478300
rosa_wichuraiana	Rw5G041670 Rw5G041680 Rw5G041710 Rw5G041720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	273
AgsI	TTSAA	5 cut(s)	55, 184, 214, 298, 381
AjnI	CCWGG	1 cut(s)	243
AluBI	AGCT	3 cut(s)	76, 110, 314
AluI	AGCT	3 cut(s)	76, 110, 314
Alw21I	GWGCWC	1 cut(s)	335
AoxI	GGCC	1 cut(s)	6
AspLEI	GCGC	1 cut(s)	105
AspS9I	GGNCC	2 cut(s)	264, 347
AsuHPI	GGTGA	1 cut(s)	170
AvaII	GGWCC	2 cut(s)	264, 347
BanII	GRGCYC	1 cut(s)	251
Bbv12I	GWGCWC	1 cut(s)	335
BccI	CCATC	4 cut(s)	17, 141, 149, 255
BciT130I	CCWGG	1 cut(s)	245
BfaI	CTAG	1 cut(s)	114
BfmI	CTRYAG	1 cut(s)	337
Bme1390I	CCNGG	1 cut(s)	245
Bme18I	GGWCC	2 cut(s)	264, 347
BmgT120I	GGNCC	2 cut(s)	264, 347
BmiI	GGNNCC	1 cut(s)	250
BmrFI	CCNGG	1 cut(s)	245
BmrI	ACTGGG	1 cut(s)	178
BmuI	ACTGGG	1 cut(s)	178
BpuEI	CTTGAG	1 cut(s)	22
BsaJI	CCNNGG	1 cut(s)	244
BsaXI	ACNNNNNCTCC	4 cut(s)	233, 263, 269, 299
Bsc4I	CCNNNNNNNGG	1 cut(s)	273
Bse1I	ACTGG	1 cut(s)	173
BseBI	CCWGG	1 cut(s)	245
BseDI	CCNNGG	1 cut(s)	244
BseGI	GGATG	2 cut(s)	76, 152
BseLI	CCNNNNNNNGG	1 cut(s)	273
BseNI	ACTGG	1 cut(s)	173
BshFI	GGCC	1 cut(s)	8
BsiHKAI	GWGCWC	1 cut(s)	335
BslI	CCNNNNNNNGG	1 cut(s)	273
BsmI	GAATGC	1 cut(s)	167
BsnI	GGCC	1 cut(s)	8
Bsp1286I	GDGCHC	2 cut(s)	251, 335
BspANI	GGCC	1 cut(s)	8
BspLI	GGNNCC	1 cut(s)	250
BsrI	ACTGG	1 cut(s)	173
BssECI	CCNNGG	1 cut(s)	244
Bst2UI	CCWGG	1 cut(s)	245
BstF5I	GGATG	2 cut(s)	76, 152
BstHHI	GCGC	1 cut(s)	105
BstNI	CCWGG	1 cut(s)	245
BstNSI	RCATGY	2 cut(s)	273, 356
BstSCI	CCNGG	1 cut(s)	243
BstSFI	CTRYAG	1 cut(s)	337
BsuRI	GGCC	1 cut(s)	8
BtsCI	GGATG	2 cut(s)	76, 152
BtsI	GCAGTG	1 cut(s)	94
BtsIMutI	CAGTG	1 cut(s)	94
CfoI	GCGC	1 cut(s)	105
Cfr13I	GGNCC	2 cut(s)	264, 347
CviAII	CATG	4 cut(s)	118, 221, 270, 353
CviJI	RGCY	6 cut(s)	8, 76, 110, 151, 249, 314
CviKI_1	RGCY	6 cut(s)	8, 76, 110, 151, 249, 314
Eco24I	GRGCYC	1 cut(s)	251
Eco47I	GGWCC	2 cut(s)	264, 347
EcoRII	CCWGG	1 cut(s)	243
EcoT38I	GRGCYC	1 cut(s)	251
FaeI	CATG	4 cut(s)	121, 224, 273, 356
FaiI	YATR	6 cut(s)	79, 119, 138, 222, 271, 354
FalI	AAGNNNNNCTT	2 cut(s)	135, 167
FatI	CATG	4 cut(s)	117, 220, 269, 352
FokI	GGATG	2 cut(s)	83, 159
FriOI	GRGCYC	1 cut(s)	251
FspBI	CTAG	1 cut(s)	114
GlaI	GCGC	1 cut(s)	104
HaeIII	GGCC	1 cut(s)	8
HhaI	GCGC	1 cut(s)	105
Hin1II	CATG	4 cut(s)	121, 224, 273, 356
Hin6I	GCGC	1 cut(s)	103
HinP1I	GCGC	1 cut(s)	103
HphI	GGTGA	1 cut(s)	170
Hpy188III	TCNNGA	1 cut(s)	39
HpyAV	CCTTC	2 cut(s)	17, 137
HpyCH4V	TGCA	5 cut(s)	165, 231, 255, 273, 356
Hsp92II	CATG	4 cut(s)	121, 224, 273, 356
HspAI	GCGC	1 cut(s)	103
LmnI	GCTCC	2 cut(s)	254, 338
LpnPI	CCDG	6 cut(s)	154, 175, 230, 257, 259, 265
MaeI	CTAG	1 cut(s)	114
MaeIII	GTNAC	1 cut(s)	89
MboII	GAAGA	1 cut(s)	202
MfeI	CAATTG	1 cut(s)	50
MhlI	GDGCHC	2 cut(s)	251, 335
MluCI	AATT	2 cut(s)	50, 131
MnlI	CCTC	1 cut(s)	321
MseI	TTAA	1 cut(s)	174
MspR9I	CCNGG	1 cut(s)	245
MunI	CAATTG	1 cut(s)	50
Mva1269I	GAATGC	1 cut(s)	167
MvaI	CCWGG	1 cut(s)	245
NlaIII	CATG	4 cut(s)	121, 224, 273, 356
NlaIV	GGNNCC	1 cut(s)	250
NmuCI	GTSAC	1 cut(s)	89
NspI	RCATGY	2 cut(s)	273, 356
PctI	GAATGC	1 cut(s)	167
Psp6I	CCWGG	1 cut(s)	243
PspGI	CCWGG	1 cut(s)	243
PspN4I	GGNNCC	1 cut(s)	250
PspPI	GGNCC	2 cut(s)	264, 347
SaqAI	TTAA	1 cut(s)	174
Sau96I	GGNCC	2 cut(s)	264, 347
ScrFI	CCNGG	1 cut(s)	245
SduI	GDGCHC	2 cut(s)	251, 335
SetI	ASST	7 cut(s)	28, 78, 112, 194, 246, 316, 332
SfcI	CTRYAG	1 cut(s)	337
SinI	GGWCC	2 cut(s)	264, 347
SmlI	CTYRAG	1 cut(s)	37
SmoI	CTYRAG	1 cut(s)	37
Sse9I	AATT	2 cut(s)	50, 131
SspMI	CTAG	1 cut(s)	114
StyD4I	CCNGG	1 cut(s)	243
TaqI	TCGA	1 cut(s)	320
TasI	AATT	2 cut(s)	50, 131
Tru1I	TTAA	1 cut(s)	174
Tru9I	TTAA	1 cut(s)	174
TscAI	CASTG	1 cut(s)	94
TseFI	GTSAC	1 cut(s)	89
Tsp45I	GTSAC	1 cut(s)	89
TspDTI	ATGAA	1 cut(s)	36
TspRI	CASTG	1 cut(s)	94
VpaK11BI	GGWCC	2 cut(s)	264, 347
XceI	RCATGY	2 cut(s)	273, 356
XspI	CTAG	1 cut(s)	114

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.