Rmu_co8218642.1_g000001

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8218642.1
Physical Location & Seq
Reverse (-)
2 .. 661
660 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8218642.1_g000001.1.cds

Sequence Viewer

Length: 290 bp
atggaagctgagatgaggaagctgaggctagagctcaagcaaacaatggacatgtacaacaccgtctgcaaggaggctctctctccagagcacaaggacatggaacttaaccgatggaaattggaagaaaaaaagagattagaagaggcacaactagctgaggaagttgcattggcacttgtacagagagaaaaagcgaatcgtaaggcagccattgaggcagcagaagcagctcaaaggattgctgaatgggaatcacaaaaaaggaggaatgcagaacagaaagccct

Protein Analysis

97

Amino Acids

11.42

Weight (kDa)

6.63

Isoelectric Point (pI)

59.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014277)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 56, 183
AflIII ACRYGT 1 cut(s) 51
AluBI AGCT 5 cut(s) 8, 22, 34, 158, 233
AluI AGCT 5 cut(s) 8, 22, 34, 158, 233
Alw21I GWGCWC 2 cut(s) 36, 93
ApeKI GCWGC 3 cut(s) 209, 221, 230
BanII GRGCYC 1 cut(s) 36
Bbv12I GWGCWC 2 cut(s) 36, 93
BbvCI CCTCAGC 2 cut(s) 23, 159
BbvI GCAGC 3 cut(s) 221, 233, 242
BccI CCATC 1 cut(s) 108
BfaI CTAG 2 cut(s) 29, 155
BglI GCCNNNNNGGC 1 cut(s) 218
BisI GCNGC 3 cut(s) 210, 222, 231
BlsI GCNGC 3 cut(s) 211, 223, 232
BplI GAGNNNNNCTC 2 cut(s) 65, 97
BpmI CTGGAG 1 cut(s) 69
Bpu10I CCTNAGC 2 cut(s) 23, 159
BpuEI CTTGAG 1 cut(s) 20
BseMII CTCAG 2 cut(s) 14, 150
BseXI GCAGC 3 cut(s) 221, 233, 242
BsiHKAI GWGCWC 2 cut(s) 36, 93
BsmI GAATGC 1 cut(s) 277
Bsp1286I GDGCHC 2 cut(s) 36, 93
Bsp1407I TGTACA 2 cut(s) 54, 181
BspCNI CTCAG 2 cut(s) 15, 151
BsrGI TGTACA 2 cut(s) 54, 181
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 138
BstAUI TGTACA 2 cut(s) 54, 181
BstDEI CTNAG 3 cut(s) 9, 23, 159
BstMWI GCNNNNNNNGC 4 cut(s) 155, 218, 227, 230
BstNSI RCATGY 1 cut(s) 55
BstV1I GCAGC 3 cut(s) 221, 233, 242
Csp6I GTAC 2 cut(s) 55, 182
CviAII CATG 2 cut(s) 52, 100
CviJI RGCY 9 cut(s) 8, 22, 28, 34, 77, 158, 212, 233, 287
CviKI_1 RGCY 9 cut(s) 8, 22, 28, 34, 77, 158, 212, 233, 287
CviQI GTAC 2 cut(s) 55, 182
DdeI CTNAG 3 cut(s) 9, 23, 159
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Ecl136II GAGCTC 1 cut(s) 34
Eco24I GRGCYC 1 cut(s) 36
Eco53kI GAGCTC 1 cut(s) 34
EcoICRI GAGCTC 1 cut(s) 34
EcoT38I GRGCYC 1 cut(s) 36
FaeI CATG 2 cut(s) 55, 103
FaiI YATR 2 cut(s) 53, 101
FatI CATG 2 cut(s) 51, 99
Fnu4HI GCNGC 3 cut(s) 210, 222, 231
FriOI GRGCYC 1 cut(s) 36
Fsp4HI GCNGC 3 cut(s) 210, 222, 231
FspBI CTAG 2 cut(s) 29, 155
GluI GCNGC 3 cut(s) 210, 222, 231
GsuI CTGGAG 1 cut(s) 69
Hin1II CATG 2 cut(s) 55, 103
HinfI GANTC 2 cut(s) 199, 254
Hpy188III TCNNGA 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 69, 170, 275
HpyF10VI GCNNNNNNNGC 4 cut(s) 155, 218, 227, 230
HpyF3I CTNAG 3 cut(s) 9, 23, 159
Hsp92II CATG 2 cut(s) 55, 103
LpnPI CCDG 1 cut(s) 99
Lsp1109I GCAGC 3 cut(s) 221, 233, 242
MaeI CTAG 2 cut(s) 29, 155
MboII GAAGA 2 cut(s) 137, 155
MhlI GDGCHC 2 cut(s) 36, 93
MluCI AATT 1 cut(s) 119
MnlI CCTC 7 cut(s) 9, 18, 67, 139, 154, 211, 261
MseI TTAA 1 cut(s) 108
Mva1269I GAATGC 1 cut(s) 277
MwoI GCNNNNNNNGC 4 cut(s) 155, 218, 227, 230
NlaIII CATG 2 cut(s) 55, 103
NspI RCATGY 1 cut(s) 55
PciI ACATGT 1 cut(s) 51
PctI GAATGC 1 cut(s) 277
PfeI GAWTC 2 cut(s) 199, 254
PkrI GCNGC 3 cut(s) 211, 223, 232
PscI ACATGT 1 cut(s) 51
Psp124BI GAGCTC 1 cut(s) 36
RsaI GTAC 2 cut(s) 56, 183
RsaNI GTAC 2 cut(s) 55, 182
SacI GAGCTC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 3 cut(s) 210, 222, 231
SduI GDGCHC 2 cut(s) 36, 93
SetI ASST 5 cut(s) 10, 24, 36, 160, 235
SgeI CNNG 9 cut(s) 41, 49, 64, 82, 98, 106, 112, 167, 191
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 1 cut(s) 119
SspMI CTAG 2 cut(s) 29, 155
SstI GAGCTC 1 cut(s) 36
TaaI ACNGT 1 cut(s) 64
TasI AATT 1 cut(s) 119
TatI WGTACW 2 cut(s) 54, 181
TfiI GAWTC 2 cut(s) 199, 254
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TseI GCWGC 3 cut(s) 209, 221, 230
XceI RCATGY 1 cut(s) 55
XspI CTAG 2 cut(s) 29, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.