Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8224134.1

Orthogroup ID

OG0007059

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 634

Gene Structure 633 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8224134.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 633 bp

ctgcaaaggaaaggggatgataatacacatgaatctcgccccccgcctttagcaaacttgtttccaactatagtgggctttgagtctgctgaagacaagaagcacaatcacagcaacaagaccaatatttcttcaaatgaaaattcatgcatccccgtagatgtgcaagagatatccacatctcagtccagcgttcctccgaaggctaagagtgaaagtttctcctccggagtatgggaaaaacctacaaaagatgaagatattgaatcgggtagtgttaagtcctcttacagtttgtccaattcaagcattgttgagggtagccgaacttctccaacatcttccacttctgtgacaacagatttaggattaggaatttgctcttctcctgctagtaagttgaacttaaatctggatgaaggacgtcaacatgacatatcaggtttctcgtcttctgatgtagatttattcaatggcaattcctctatttatactgctcagtcatcattctgctcaagtcctgacaaacatgggcagtttgatccaagtgatgtcaagatgcttttcagagccctctttgagagagtgggctggcaaactgaagctataagtgctattagccaacgaatagct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009719 GO:0009725 GO:0010033 GO:0014070 GO:0033993 GO:0042221 GO:0050896 GO:1901700 GO:1902347

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA_2 Clp_N

Protein Analysis

211

Amino Acids

22.74

Weight (kDa)

5.1

Isoelectric Point (pI)

55.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007059)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G40130 AT2G40130
fragaria_vesca	FvH4_7g24540 FvH4_7g24540
malus_domestica	MD01G1153400.v1.1 MD07G1222400.v1.1
prunus_persica	Prupe.2G250700_v2.0.a1 Prupe.2G250700_v2.0.a1
pyrus_communis	pycom01g17100 pycom07g20100 pycom07g20110
rosa_chinensis	RchiOBHm_Chr1g0370371
rosa_laevigata	RLG00000027054
rosa_multiflora	Rmu_co8224134.1_g000001 Rmu_co8315027.1_g000001 Rmu_sc0006707.1_g000030 Rmu_sc0029129.1_g000001
rosa_roxburghii	Rroxscaffold_4G00286640
rosa_rugosa	Rorug01G0355800 Rorug01G0355900
rosa_samantha	Rh1AG364200 Rh1BG327500 Rh1CG340500 Rh1DG357800
rosa_wichuraiana	Rw1G032050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	427
AccIII	TCCGGA	1 cut(s)	227
AciI	CCGC	1 cut(s)	44
AclWI	GGATC	1 cut(s)	536
AcsI	RAATTY	2 cut(s)	142, 375
AcuI	CTGAAG	2 cut(s)	111, 621
AcyI	GRCGYC	1 cut(s)	424
AfiI	CCNNNNNNNGG	1 cut(s)	234
AgsI	TTSAA	5 cut(s)	135, 266, 306, 403, 472
AleI	CACNNNNGTG	1 cut(s)	350
AluBI	AGCT	2 cut(s)	605, 632
AluI	AGCT	2 cut(s)	605, 632
AlwI	GGATC	1 cut(s)	536
Aor13HI	TCCGGA	1 cut(s)	227
ApoI	RAATTY	2 cut(s)	142, 375
BanII	GRGCYC	1 cut(s)	574
BarI	GAAGNNNNNNTAC	2 cut(s)	313, 345
BbsI	GAAGAC	2 cut(s)	99, 444
BfaI	CTAG	1 cut(s)	393
BfmI	CTRYAG	1 cut(s)	69
BmsI	GCATC	2 cut(s)	159, 549
BpiI	GAAGAC	2 cut(s)	99, 444
BpuEI	CTTGAG	1 cut(s)	499
BsaHI	GRCGYC	1 cut(s)	424
BsaWI	WCCGGW	1 cut(s)	227
Bsc4I	CCNNNNNNNGG	1 cut(s)	234
BseAI	TCCGGA	1 cut(s)	227
BseGI	GGATG	3 cut(s)	22, 150, 421
BseLI	CCNNNNNNNGG	1 cut(s)	234
BseMII	CTCAG	2 cut(s)	197, 512
BseRI	GAGGAG	1 cut(s)	214
BsiSI	CCGG	1 cut(s)	228
BslI	CCNNNNNNNGG	1 cut(s)	234
Bsp1286I	GDGCHC	1 cut(s)	574
Bsp13I	TCCGGA	1 cut(s)	227
Bsp143I	GATC	1 cut(s)	541
BspACI	CCGC	1 cut(s)	44
BspCNI	CTCAG	2 cut(s)	196, 511
BspEI	TCCGGA	1 cut(s)	227
BspPI	GGATC	1 cut(s)	536
BspQI	GCTCTTC	1 cut(s)	388
BssMI	GATC	1 cut(s)	541
BssNI	GRCGYC	1 cut(s)	424
Bst4CI	ACNGT	1 cut(s)	293
Bst6I	CTCTTC	1 cut(s)	388
BstACI	GRCGYC	1 cut(s)	424
BstC8I	GCNNGC	1 cut(s)	593
BstDEI	CTNAG	3 cut(s)	183, 207, 498
BstF5I	GGATG	3 cut(s)	22, 150, 421
BstKTI	GATC	1 cut(s)	544
BstMBI	GATC	1 cut(s)	541
BstMWI	GCNNNNNNNGC	1 cut(s)	611
BstSFI	CTRYAG	1 cut(s)	69
BstV2I	GAAGAC	2 cut(s)	99, 444
BtsCI	GGATG	3 cut(s)	22, 150, 421
Cac8I	GCNNGC	1 cut(s)	593
CspCI	CAANNNNNGTGG	2 cut(s)	54, 89
CviAII	CATG	4 cut(s)	29, 147, 431, 530
CviJI	RGCY	8 cut(s)	78, 206, 324, 572, 591, 605, 621, 632
CviKI_1	RGCY	8 cut(s)	78, 206, 324, 572, 591, 605, 621, 632
DdeI	CTNAG	3 cut(s)	183, 207, 498
DpnI	GATC	1 cut(s)	543
DpnII	GATC	1 cut(s)	541
Eam1104I	CTCTTC	1 cut(s)	388
EarI	CTCTTC	1 cut(s)	388
Eco24I	GRGCYC	1 cut(s)	574
Eco32I	GATATC	1 cut(s)	174
Eco57I	CTGAAG	2 cut(s)	111, 621
EcoRV	GATATC	1 cut(s)	174
EcoT22I	ATGCAT	1 cut(s)	152
EcoT38I	GRGCYC	1 cut(s)	574
FaeI	CATG	4 cut(s)	32, 150, 434, 533
FaiI	YATR	9 cut(s)	30, 71, 148, 235, 432, 437, 492, 531, 608
FalI	AAGNNNNNCTT	2 cut(s)	389, 421
FatI	CATG	4 cut(s)	28, 146, 430, 529
FauI	CCCGC	1 cut(s)	51
FokI	GGATG	3 cut(s)	29, 137, 428
FriOI	GRGCYC	1 cut(s)	574
FspBI	CTAG	1 cut(s)	393
HapII	CCGG	1 cut(s)	228
Hin1I	GRCGYC	1 cut(s)	424
Hin1II	CATG	4 cut(s)	32, 150, 434, 533
HincII	GTYRAC	1 cut(s)	428
HindII	GTYRAC	1 cut(s)	428
HinfI	GANTC	3 cut(s)	32, 83, 266
HpaII	CCGG	1 cut(s)	228
Hpy166II	GTNNAC	1 cut(s)	428
Hpy188I	TCNGA	3 cut(s)	201, 457, 569
Hpy188III	TCNNGA	4 cut(s)	228, 413, 521, 556
Hpy8I	GTNNAC	1 cut(s)	428
HpyAV	CCTTC	2 cut(s)	196, 413
HpyCH4III	ACNGT	1 cut(s)	293
HpyCH4IV	ACGT	1 cut(s)	424
HpyCH4V	TGCA	3 cut(s)	4, 150, 166
HpyF10VI	GCNNNNNNNGC	1 cut(s)	611
HpyF3I	CTNAG	3 cut(s)	183, 207, 498
HpySE526I	ACGT	1 cut(s)	424
Hsp92I	GRCGYC	1 cut(s)	424
Hsp92II	CATG	4 cut(s)	32, 150, 434, 533
Kpn2I	TCCGGA	1 cut(s)	227
Kzo9I	GATC	1 cut(s)	541
LguI	GCTCTTC	1 cut(s)	388
LpnPI	CCDG	7 cut(s)	202, 241, 398, 402, 426, 534, 577
LweI	GCATC	2 cut(s)	159, 549
MaeI	CTAG	1 cut(s)	393
MaeII	ACGT	1 cut(s)	424
MaeIII	GTNAC	1 cut(s)	352
MalI	GATC	1 cut(s)	543
MboI	GATC	1 cut(s)	541
MboII	GAAGA	6 cut(s)	104, 123, 269, 333, 375, 444
MhlI	GDGCHC	1 cut(s)	574
MluCI	AATT	4 cut(s)	142, 301, 375, 478
MlyI	GAGTC	1 cut(s)	92
MmeI	TCCRAC	2 cut(s)	89, 359
MnlI	CCTC	6 cut(s)	207, 235, 295, 310, 493, 584
Mph1103I	ATGCAT	1 cut(s)	152
MroI	TCCGGA	1 cut(s)	227
MseI	TTAA	2 cut(s)	279, 407
MslI	CAYNNNNRTG	1 cut(s)	350
MspI	CCGG	1 cut(s)	228
MwoI	GCNNNNNNNGC	1 cut(s)	611
NdeII	GATC	1 cut(s)	541
NlaIII	CATG	4 cut(s)	32, 150, 434, 533
NmuCI	GTSAC	1 cut(s)	352
NsiI	ATGCAT	1 cut(s)	152
OliI	CACNNNNGTG	1 cut(s)	350
PciSI	GCTCTTC	1 cut(s)	388
PfeI	GAWTC	2 cut(s)	32, 266
PleI	GAGTC	1 cut(s)	91
PpsI	GAGTC	1 cut(s)	91
RseI	CAYNNNNRTG	1 cut(s)	350
SapI	GCTCTTC	1 cut(s)	388
SaqAI	TTAA	2 cut(s)	279, 407
Sau3AI	GATC	1 cut(s)	541
SchI	GAGTC	1 cut(s)	92
SduI	GDGCHC	1 cut(s)	574
SetI	ASST	4 cut(s)	247, 427, 445, 607
SfaNI	GCATC	2 cut(s)	159, 549
SfcI	CTRYAG	1 cut(s)	69
SmiMI	CAYNNNNRTG	1 cut(s)	350
SmlI	CTYRAG	1 cut(s)	514
SmoI	CTYRAG	1 cut(s)	514
Sse9I	AATT	4 cut(s)	142, 301, 375, 478
SsiI	CCGC	1 cut(s)	44
SspI	AATATT	1 cut(s)	127
SspMI	CTAG	1 cut(s)	393
TaaI	ACNGT	1 cut(s)	293
TaiI	ACGT	1 cut(s)	427
TasI	AATT	4 cut(s)	142, 301, 375, 478
TfiI	GAWTC	2 cut(s)	32, 266
Tru1I	TTAA	2 cut(s)	279, 407
Tru9I	TTAA	2 cut(s)	279, 407
TseFI	GTSAC	1 cut(s)	352
Tsp45I	GTSAC	1 cut(s)	352
TspDTI	ATGAA	5 cut(s)	45, 135, 153, 270, 432
XapI	RAATTY	2 cut(s)	142, 375
XspI	CTAG	1 cut(s)	393
ZraI	GACGTC	1 cut(s)	425
Zsp2I	ATGCAT	1 cut(s)	152

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.