Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8231115.1

Orthogroup ID

OG0014719

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 571

Gene Structure 571 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8231115.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 464 bp

gaagtttagcagtgtctaaagcctcgtcgcgagcattactttttgaagctaatgattccatgaatattttgcaagcatttgagaactggatgaaagagcatggacgcacttactcaagcagtgaggagaaggcagagcgttttgcaatattcaaggaggagtttgatcatatagaaaacttcaacaggcaagggaaacatagattcacattaggcctcaatgcattcagtgatctgactgataaagagttcgatgagacatatggttgcacgattgctataccaacaaacacaaaccctagctcagtctcttcttttagctatcaagattttgaaattgaggatcttccccaaaactgggactggaggacacaacgagctgtgaccagtgtcaaggaccaaggaaaatgtggtaagagaaggaaatccctaaattttaaccaattattggttgtatattcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 ko04142 ko04145 ko04210 ko04612 ko04621 ko04924 ko05205 ko05323 ko05418 map04140 map04142 map04145 map04210 map04612 map04621 map04924 map05205 map05323 map05418

Pfam Domains

Protein Families

Granulin Inhibitor_I29 Peptidase_C1

Protein Analysis

153

Amino Acids

17.68

Weight (kDa)

5.65

Isoelectric Point (pI)

45.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014719)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g20390 FvH4_5g18392
pyrus_communis	pycom10g12240
rosa_chinensis	RchiOBHm_Chr5g0010531
rosa_laevigata	RLG00000031759 RLG00000034399
rosa_multiflora	Rmu_co8231115.1_g000001 Rmu_sc0006579.1_g000004 Rmu_sc0021314.1_g000001 Rmu_sc0021314.1_g000002
rosa_roxburghii	Rroxscaffold_1G00035160 Rroxscaffold_1G00065800 Rroxscaffold_1G00065810
rosa_samantha	Rh5AG082200 Rh5BG077100
rosa_wichuraiana	Rw0G000750 Rw0G000760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	447
AccII	CGCG	1 cut(s)	30
AclWI	GGATC	1 cut(s)	350
AcsI	RAATTY	1 cut(s)	432
AfiI	CCNNNNNNNGG	3 cut(s)	356, 357, 447
AgsI	TTSAA	4 cut(s)	46, 153, 183, 334
AluBI	AGCT	4 cut(s)	49, 302, 320, 379
AluI	AGCT	4 cut(s)	49, 302, 320, 379
Alw26I	GTCTC	2 cut(s)	250, 312
AlwI	GGATC	1 cut(s)	350
AoxI	GGCC	1 cut(s)	213
ApoI	RAATTY	1 cut(s)	432
AspS9I	GGNCC	1 cut(s)	396
AvaII	GGWCC	1 cut(s)	396
BclI	TGATCA	1 cut(s)	165
BcoDI	GTCTC	2 cut(s)	250, 312
BfaI	CTAG	1 cut(s)	299
Bme18I	GGWCC	1 cut(s)	396
BmgT120I	GGNCC	1 cut(s)	396
BmrI	ACTGGG	1 cut(s)	366
BmuI	ACTGGG	1 cut(s)	366
BoxI	GACNNNNGTC	1 cut(s)	388
BpmI	CTGGAG	1 cut(s)	384
BpuEI	CTTGAG	1 cut(s)	99
BsaJI	CCNNGG	1 cut(s)	399
Bsc4I	CCNNNNNNNGG	3 cut(s)	356, 357, 447
Bse1I	ACTGG	4 cut(s)	91, 361, 367, 386
BseDI	CCNNGG	1 cut(s)	399
BseGI	GGATG	1 cut(s)	95
BseLI	CCNNNNNNNGG	3 cut(s)	356, 357, 447
BseMII	CTCAG	1 cut(s)	317
BseNI	ACTGG	4 cut(s)	91, 361, 367, 386
BseRI	GAGGAG	2 cut(s)	139, 172
Bsh1236I	CGCG	1 cut(s)	30
BshFI	GGCC	1 cut(s)	215
BslFI	GGGAC	1 cut(s)	373
BslI	CCNNNNNNNGG	3 cut(s)	356, 357, 447
BsmAI	GTCTC	2 cut(s)	250, 312
BsmFI	GGGAC	1 cut(s)	373
BsmI	GAATGC	1 cut(s)	223
BsnI	GGCC	1 cut(s)	215
Bsp143I	GATC	3 cut(s)	165, 231, 342
Bsp68I	TCGCGA	1 cut(s)	30
BspANI	GGCC	1 cut(s)	215
BspCNI	CTCAG	1 cut(s)	316
BspFNI	CGCG	1 cut(s)	30
BspPI	GGATC	1 cut(s)	350
BsrI	ACTGG	4 cut(s)	91, 361, 367, 386
BssECI	CCNNGG	1 cut(s)	399
BssMI	GATC	3 cut(s)	165, 231, 342
BssT1I	CCWWGG	1 cut(s)	399
Bst6I	CTCTTC	1 cut(s)	315
BstC8I	GCNNGC	2 cut(s)	32, 74
BstDEI	CTNAG	1 cut(s)	303
BstF5I	GGATG	1 cut(s)	95
BstFNI	CGCG	1 cut(s)	30
BstKTI	GATC	3 cut(s)	168, 234, 345
BstMAI	GTCTC	2 cut(s)	250, 312
BstMBI	GATC	3 cut(s)	165, 231, 342
BstPAI	GACNNNNGTC	1 cut(s)	388
BstUI	CGCG	1 cut(s)	30
BstX2I	RGATCY	1 cut(s)	342
BstYI	RGATCY	1 cut(s)	342
BsuRI	GGCC	1 cut(s)	215
BtsCI	GGATG	1 cut(s)	95
BtsI	GCAGTG	2 cut(s)	17, 126
BtsIMutI	CAGTG	4 cut(s)	17, 126, 234, 393
BtuMI	TCGCGA	1 cut(s)	30
Cac8I	GCNNGC	2 cut(s)	32, 74
Cfr13I	GGNCC	1 cut(s)	396
CseI	GACGC	1 cut(s)	113
CviAII	CATG	2 cut(s)	60, 100
CviJI	RGCY	6 cut(s)	22, 49, 215, 302, 320, 379
CviKI_1	RGCY	6 cut(s)	22, 49, 215, 302, 320, 379
DdeI	CTNAG	1 cut(s)	303
DpnI	GATC	3 cut(s)	167, 233, 344
DpnII	GATC	3 cut(s)	165, 231, 342
Eam1104I	CTCTTC	1 cut(s)	315
EarI	CTCTTC	1 cut(s)	315
Eco130I	CCWWGG	1 cut(s)	399
Eco147I	AGGCCT	1 cut(s)	215
Eco47I	GGWCC	1 cut(s)	396
EcoT14I	CCWWGG	1 cut(s)	399
EcoT22I	ATGCAT	1 cut(s)	225
ErhI	CCWWGG	1 cut(s)	399
FaeI	CATG	2 cut(s)	63, 103
FaiI	YATR	9 cut(s)	61, 101, 170, 172, 200, 261, 263, 280, 456
FaqI	GGGAC	1 cut(s)	373
FatI	CATG	2 cut(s)	59, 99
FauNDI	CATATG	1 cut(s)	261
FbaI	TGATCA	1 cut(s)	165
FokI	GGATG	1 cut(s)	102
FspBI	CTAG	1 cut(s)	299
GsuI	CTGGAG	1 cut(s)	384
HaeIII	GGCC	1 cut(s)	215
HgaI	GACGC	1 cut(s)	113
Hin1II	CATG	2 cut(s)	63, 103
HinfI	GANTC	2 cut(s)	55, 203
Hpy188I	TCNGA	1 cut(s)	236
Hpy188III	TCNNGA	2 cut(s)	29, 325
Hpy99I	CGWCG	1 cut(s)	30
HpyAV	CCTTC	2 cut(s)	123, 413
HpyCH4V	TGCA	4 cut(s)	72, 145, 223, 269
HpyF3I	CTNAG	1 cut(s)	303
Hsp92II	CATG	2 cut(s)	63, 103
Ksp22I	TGATCA	1 cut(s)	165
Kzo9I	GATC	3 cut(s)	165, 231, 342
LpnPI	CCDG	5 cut(s)	72, 171, 342, 348, 399
MaeI	CTAG	1 cut(s)	299
MaeIII	GTNAC	1 cut(s)	381
MalI	GATC	3 cut(s)	167, 233, 344
MboI	GATC	3 cut(s)	165, 231, 342
MboII	GAAGA	2 cut(s)	302, 337
MflI	RGATCY	1 cut(s)	342
MluCI	AATT	3 cut(s)	335, 432, 442
MnlI	CCTC	6 cut(s)	33, 117, 150, 226, 333, 359
Mph1103I	ATGCAT	1 cut(s)	225
MseI	TTAA	2 cut(s)	437, 462
Mva1269I	GAATGC	1 cut(s)	223
MvnI	CGCG	1 cut(s)	30
NdeI	CATATG	1 cut(s)	261
NdeII	GATC	3 cut(s)	165, 231, 342
NlaIII	CATG	2 cut(s)	63, 103
NmuCI	GTSAC	1 cut(s)	381
NruI	TCGCGA	1 cut(s)	30
NsiI	ATGCAT	1 cut(s)	225
PceI	AGGCCT	1 cut(s)	215
PctI	GAATGC	1 cut(s)	223
PfeI	GAWTC	2 cut(s)	55, 203
PflMI	CCANNNNNTGG	1 cut(s)	447
PshAI	GACNNNNGTC	1 cut(s)	388
PspPI	GGNCC	1 cut(s)	396
PsuI	RGATCY	1 cut(s)	342
RruI	TCGCGA	1 cut(s)	30
SaqAI	TTAA	2 cut(s)	437, 462
Sau3AI	GATC	3 cut(s)	165, 231, 342
Sau96I	GGNCC	1 cut(s)	396
SetI	ASST	4 cut(s)	51, 304, 322, 381
SinI	GGWCC	1 cut(s)	396
SmlI	CTYRAG	1 cut(s)	114
SmoI	CTYRAG	1 cut(s)	114
Sse9I	AATT	3 cut(s)	335, 432, 442
SseBI	AGGCCT	1 cut(s)	215
SspI	AATATT	2 cut(s)	66, 149
SspMI	CTAG	1 cut(s)	299
StuI	AGGCCT	1 cut(s)	215
StyI	CCWWGG	1 cut(s)	399
TaqI	TCGA	1 cut(s)	251
TasI	AATT	3 cut(s)	335, 432, 442
TfiI	GAWTC	2 cut(s)	55, 203
Tru1I	TTAA	2 cut(s)	437, 462
Tru9I	TTAA	2 cut(s)	437, 462
TscAI	CASTG	4 cut(s)	17, 126, 234, 393
TseFI	GTSAC	1 cut(s)	381
Tsp45I	GTSAC	1 cut(s)	381
TspDTI	ATGAA	2 cut(s)	76, 106
TspRI	CASTG	4 cut(s)	17, 126, 234, 393
Van91I	CCANNNNNTGG	1 cut(s)	447
VpaK11BI	GGWCC	1 cut(s)	396
XapI	RAATTY	1 cut(s)	432
XcmI	CCANNNNNNNNNTGG	1 cut(s)	406
XspI	CTAG	1 cut(s)	299
Zsp2I	ATGCAT	1 cut(s)	225

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.