Rmu_co8232119.1_g000001

DNA-binding protein ESCAROLA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8232119.1
OG0005616
Physical Location & Seq
Forward (+)
1 .. 408
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8232119.1_g000001.1.cds

Sequence Viewer

Length: 217 bp
ttttgtatatggtagctccaacaagatcaagagcaagccagtggctgaccccaataatgggcagagttctgagcctcagcacagtgagaaattaccttcaccggctgcagctccatctactcaaaattatgctccatccacagcaggcatttggcctggggggcggctagttgatgcgagaaatgctcacaccggtattgacttgactcgcggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0005515 GO:0043621
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF296

Protein Analysis

71

Amino Acids

7.4

Weight (kDa)

9.31

Isoelectric Point (pI)

49.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 211
AciI CCGC 2 cut(s) 164, 211
AfiI CCNNNNNNNGG 2 cut(s) 57, 58
AgeI ACCGGT 1 cut(s) 192
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 2 cut(s) 16, 111
AluI AGCT 2 cut(s) 16, 111
AlwNI CAGNNNCTG 1 cut(s) 45
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 2 cut(s) 105, 108
AsiGI ACCGGT 1 cut(s) 192
AsuHPI GGTGA 1 cut(s) 91
BbvCI CCTCAGC 1 cut(s) 76
BbvI GCAGC 2 cut(s) 92, 120
BccI CCATC 2 cut(s) 122, 143
BciT130I CCWGG 1 cut(s) 157
BfaI CTAG 1 cut(s) 168
BfmI CTRYAG 1 cut(s) 106
BglI GCCNNNNNGGC 1 cut(s) 161
BisI GCNGC 3 cut(s) 106, 109, 165
BlsI GCNGC 3 cut(s) 107, 110, 166
Bme1390I CCNGG 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 1 cut(s) 164
BplI GAGNNNNNCTC 2 cut(s) 170, 202
Bpu10I CCTNAGC 1 cut(s) 76
BsaJI CCNNGG 1 cut(s) 156
BsaWI WCCGGW 1 cut(s) 192
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 58
Bse118I RCCGGY 2 cut(s) 101, 192
Bse1I ACTGG 1 cut(s) 39
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 57, 58
BseMII CTCAG 2 cut(s) 61, 90
BseNI ACTGG 1 cut(s) 39
BseXI GCAGC 2 cut(s) 92, 120
Bsh1236I CGCG 1 cut(s) 211
BshFI GGCC 1 cut(s) 155
BshTI ACCGGT 1 cut(s) 192
BsiSI CCGG 2 cut(s) 102, 193
BslI CCNNNNNNNGG 2 cut(s) 57, 58
BsnI GGCC 1 cut(s) 155
Bsp143I GATC 1 cut(s) 25
BspACI CCGC 2 cut(s) 164, 211
BspANI GGCC 1 cut(s) 155
BspCNI CTCAG 2 cut(s) 62, 89
BspFNI CGCG 1 cut(s) 211
BspMAI CTGCAG 1 cut(s) 110
BsrFI RCCGGY 2 cut(s) 101, 192
BsrI ACTGG 1 cut(s) 39
BssAI RCCGGY 2 cut(s) 101, 192
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 157
Bst4CI ACNGT 1 cut(s) 84
BstC8I GCNNGC 2 cut(s) 36, 146
BstDEI CTNAG 2 cut(s) 70, 76
BstF5I GGATG 1 cut(s) 135
BstFNI CGCG 1 cut(s) 211
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 2 cut(s) 161, 183
BstNI CCWGG 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 106
BstUI CGCG 1 cut(s) 211
BstV1I GCAGC 2 cut(s) 92, 120
BsuRI GGCC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 135
BtsIMutI CAGTG 2 cut(s) 46, 89
Cac8I GCNNGC 2 cut(s) 36, 146
CaiI CAGNNNCTG 1 cut(s) 45
Cfr10I RCCGGY 2 cut(s) 101, 192
CspAI ACCGGT 1 cut(s) 192
CviJI RGCY 8 cut(s) 16, 38, 45, 74, 105, 111, 155, 167
CviKI_1 RGCY 8 cut(s) 16, 38, 45, 74, 105, 111, 155, 167
DdeI CTNAG 2 cut(s) 70, 76
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
EcoRII CCWGG 1 cut(s) 155
FaiI YATR 3 cut(s) 8, 10, 130
Fnu4HI GCNGC 3 cut(s) 106, 109, 165
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 3 cut(s) 106, 109, 165
FspBI CTAG 1 cut(s) 168
GluI GCNGC 3 cut(s) 106, 109, 165
HaeIII GGCC 1 cut(s) 155
HapII CCGG 2 cut(s) 102, 193
HinfI GANTC 1 cut(s) 206
HpaII CCGG 2 cut(s) 102, 193
HphI GGTGA 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 2 cut(s) 161, 183
HpyF3I CTNAG 2 cut(s) 70, 76
Kzo9I GATC 1 cut(s) 25
LmnI GCTCC 3 cut(s) 21, 116, 137
LpnPI CCDG 6 cut(s) 52, 115, 130, 142, 169, 206
Lsp1109I GCAGC 2 cut(s) 92, 120
LweI GCATC 1 cut(s) 164
MaeI CTAG 1 cut(s) 168
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MluCI AATT 2 cut(s) 90, 125
MlyI GAGTC 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 43
MnlI CCTC 1 cut(s) 85
MspI CCGG 2 cut(s) 102, 193
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
MvnI CGCG 1 cut(s) 211
MwoI GCNNNNNNNGC 2 cut(s) 161, 183
NdeII GATC 1 cut(s) 25
PinAI ACCGGT 1 cut(s) 192
PkrI GCNGC 3 cut(s) 107, 110, 166
PleI GAGTC 1 cut(s) 200
PpsI GAGTC 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PstI CTGCAG 1 cut(s) 110
PstNI CAGNNNCTG 1 cut(s) 45
SatI GCNGC 3 cut(s) 106, 109, 165
Sau3AI GATC 1 cut(s) 25
SchI GAGTC 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 157
SetI ASST 3 cut(s) 18, 98, 113
SfaNI GCATC 1 cut(s) 164
SfcI CTRYAG 1 cut(s) 106
Sse9I AATT 2 cut(s) 90, 125
SsiI CCGC 2 cut(s) 164, 211
SspMI CTAG 1 cut(s) 168
StyD4I CCNGG 1 cut(s) 155
TaaI ACNGT 1 cut(s) 84
TasI AATT 2 cut(s) 90, 125
TauI GCSGC 1 cut(s) 167
TscAI CASTG 2 cut(s) 46, 89
TseI GCWGC 2 cut(s) 105, 108
TspRI CASTG 2 cut(s) 46, 89
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.