Rmu_sc0016104.1_g000006

DNA-binding protein ESCAROLA

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016104.1
Physical Location & Seq
Reverse (-)
15148 .. 19418
4271 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016104.1_g000006.1.cds

Sequence Viewer

Length: 1047 bp
atggccatctctggtgctcaagcttcatactacatccataggggaggccatggtgggtcttcgcctggatcacagattgctgggctgcatgcaccccctgggttcaggcccaacaacactgcctttcaacaagctcagtctaatgtgagggcctcctcagcattctcagtagagccttcttcgagacccaattaccctcatggcattagcatcaatgtttctcccggaggagctccttcttctggtgagcctgtaaagaagaaacgagggaggccccggaagtatgggcctggccctgctcctggccctggttcggctcctgatgccccggtttctctggcattgtctccaatgtcttcaactcctaatcctactccaggatcaacctcaccgactccgaaacgaaacagaggaaggccacctgggactggcaggaaacaacaattggctaatcttggggaatggatgaacagttcggctggacaggcttttgcaccccatgttatcaccattgaagctggagaggacattgcagcaaaattattgttattttcacaacagaggccaagggcactatgcatcttgtcaggaaatggaacagtatcttcagtagcactgcgtcagcctgcatcaactggtgtcagtgtcacatatgagggtcgtttccagatattatgcttgtcaggttcttacctggttgctgaggatggtggcccccgcgatcgaacaggggggataagcgtttccctttctagttctgatggtcatgtcattggtggtgctgtggctatgcttattgcagcaactccagtgcagattgtgctttgcagttttgtatatggtagctccaacaagatcaagagcaagccagtggctgaccccaataatgggcagagttctgagcctcagcacagtgagaaattaccttcaccggctacagctccatctactcaaaattatgctccatccacagcaggcatttggcctggggggcggctagttgatgcgagaaatgctcacaccggtattgacttgactcgcggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

348

Amino Acids

35.62

Weight (kDa)

10.05

Isoelectric Point (pI)

50.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 720, 1041
AciI CCGC 3 cut(s) 718, 994, 1041
AclWI GGATC 2 cut(s) 76, 388
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 591
AfiI CCNNNNNNNGG 8 cut(s) 242, 302, 308, 313, 377, 428, 887, 888
AgeI ACCGGT 1 cut(s) 1022
AgsI TTSAA 3 cut(s) 128, 360, 515
AjnI CCWGG 9 cut(s) 64, 97, 289, 301, 307, 376, 421, 693, 985
AjuI GAANNNNNNNTTGG 2 cut(s) 428, 460
AloI GAACNNNNNNTCC 2 cut(s) 457, 489
AluBI AGCT 6 cut(s) 23, 134, 233, 518, 846, 941
AluI AGCT 6 cut(s) 23, 134, 233, 518, 846, 941
Alw21I GWGCWC 2 cut(s) 19, 235
Alw26I GTCTC 2 cut(s) 178, 351
AlwI GGATC 2 cut(s) 76, 388
AlwNI CAGNNNCTG 1 cut(s) 875
ApeKI GCWGC 3 cut(s) 85, 533, 800
AsiGI ACCGGT 1 cut(s) 1022
AspS9I GGNCC 7 cut(s) 108, 150, 273, 287, 293, 305, 713
AsuC2I CCSGG 3 cut(s) 225, 277, 329
AsuHPI GGTGA 4 cut(s) 257, 381, 499, 921
BaeGI GKGCMC 1 cut(s) 574
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 235
BbsI GAAGAC 2 cut(s) 51, 348
Bbv12I GWGCWC 2 cut(s) 19, 235
BbvCI CCTCAGC 3 cut(s) 157, 702, 906
BbvI GCAGC 3 cut(s) 72, 545, 812
BccI CCATC 5 cut(s) 14, 701, 755, 952, 973
BciT130I CCWGG 9 cut(s) 66, 99, 291, 303, 309, 378, 423, 695, 987
BcnI CCSGG 3 cut(s) 225, 277, 329
BcoDI GTCTC 2 cut(s) 178, 351
BfaI CTAG 2 cut(s) 753, 998
BfmI CTRYAG 1 cut(s) 936
BglI GCCNNNNNGGC 1 cut(s) 991
BisI GCNGC 4 cut(s) 86, 534, 801, 995
BlsI GCNGC 4 cut(s) 87, 535, 802, 996
BmgT120I GGNCC 7 cut(s) 108, 150, 273, 287, 293, 305, 713
BmiI GGNNCC 3 cut(s) 275, 318, 715
BmsI GCATC 5 cut(s) 219, 313, 588, 638, 994
BpiI GAAGAC 2 cut(s) 51, 348
BplI GAGNNNNNCTC 2 cut(s) 1000, 1032
BpmI CTGGAG 3 cut(s) 360, 540, 792
Bpu10I CCTNAGC 3 cut(s) 157, 702, 906
BpuMI CCSGG 3 cut(s) 225, 277, 329
BsaI GGTCTC 1 cut(s) 178
BsaJI CCNNGG 9 cut(s) 49, 97, 98, 275, 307, 327, 422, 566, 986
BsaWI WCCGGW 1 cut(s) 1022
Bsc4I CCNNNNNNNGG 8 cut(s) 242, 302, 308, 313, 377, 428, 887, 888
Bse118I RCCGGY 2 cut(s) 931, 1022
Bse1I ACTGG 4 cut(s) 433, 640, 809, 869
Bse3DI GCAATG 1 cut(s) 528
BseBI CCWGG 9 cut(s) 66, 99, 291, 303, 309, 378, 423, 695, 987
BseDI CCNNGG 9 cut(s) 49, 97, 98, 275, 307, 327, 422, 566, 986
BseGI GGATG 4 cut(s) 33, 471, 712, 965
BseLI CCNNNNNNNGG 8 cut(s) 242, 302, 308, 313, 377, 428, 887, 888
BseMI GCAATG 1 cut(s) 528
BseMII CTCAG 6 cut(s) 149, 171, 180, 693, 891, 920
BseNI ACTGG 4 cut(s) 433, 640, 809, 869
BseRI GAGGAG 2 cut(s) 145, 243
BseSI GKGCMC 1 cut(s) 574
BseXI GCAGC 3 cut(s) 72, 545, 812
BseYI CCCAGC 1 cut(s) 80
BsgI GTGCAG 1 cut(s) 833
Bsh1236I CGCG 2 cut(s) 720, 1041
Bsh1285I CGRYCG 1 cut(s) 724
BshTI ACCGGT 1 cut(s) 1022
BsiEI CGRYCG 1 cut(s) 724
BsiHKAI GWGCWC 2 cut(s) 19, 235
BsiSI CCGG 5 cut(s) 225, 277, 329, 932, 1023
BslFI GGGAC 1 cut(s) 439
BslI CCNNNNNNNGG 8 cut(s) 242, 302, 308, 313, 377, 428, 887, 888
BsmAI GTCTC 2 cut(s) 178, 351
BsmFI GGGAC 1 cut(s) 439
BsmI GAATGC 1 cut(s) 161
Bso31I GGTCTC 1 cut(s) 178
Bsp1286I GDGCHC 3 cut(s) 19, 235, 574
Bsp143I GATC 4 cut(s) 68, 380, 721, 855
Bsp19I CCATGG 1 cut(s) 49
BspACI CCGC 3 cut(s) 718, 994, 1041
BspCNI CTCAG 6 cut(s) 148, 170, 179, 694, 892, 919
BspFNI CGCG 2 cut(s) 720, 1041
BspLI GGNNCC 3 cut(s) 275, 318, 715
BspPI GGATC 2 cut(s) 76, 388
BspTNI GGTCTC 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 528
BsrFI RCCGGY 2 cut(s) 931, 1022
BsrI ACTGG 4 cut(s) 433, 640, 809, 869
BssAI RCCGGY 2 cut(s) 931, 1022
BssECI CCNNGG 9 cut(s) 49, 97, 98, 275, 307, 327, 422, 566, 986
BssMI GATC 4 cut(s) 68, 380, 721, 855
BssT1I CCWWGG 2 cut(s) 49, 566
Bst2UI CCWGG 9 cut(s) 66, 99, 291, 303, 309, 378, 423, 695, 987
Bst4CI ACNGT 3 cut(s) 473, 601, 914
BstAPI GCANNNNNTGC 1 cut(s) 820
BstC8I GCNNGC 4 cut(s) 90, 627, 866, 976
BstDEI CTNAG 6 cut(s) 135, 157, 166, 702, 900, 906
BstDSI CCRYGG 1 cut(s) 49
BstENI CCTNNNNNAGG 1 cut(s) 375
BstF5I GGATG 4 cut(s) 33, 471, 712, 965
BstFNI CGCG 2 cut(s) 720, 1041
BstKTI GATC 4 cut(s) 71, 383, 724, 858
BstMAI GTCTC 2 cut(s) 178, 351
BstMBI GATC 4 cut(s) 68, 380, 721, 855
BstMCI CGRYCG 1 cut(s) 724
BstMWI GCNNNNNNNGC 6 cut(s) 158, 323, 485, 820, 991, 1013
BstNI CCWGG 9 cut(s) 66, 99, 291, 303, 309, 378, 423, 695, 987
BstNSI RCATGY 1 cut(s) 92
BstSFI CTRYAG 1 cut(s) 936
BstSLI GKGCMC 1 cut(s) 574
BstUI CGCG 2 cut(s) 720, 1041
BstV1I GCAGC 3 cut(s) 72, 545, 812
BstV2I GAAGAC 2 cut(s) 51, 348
BtgI CCRYGG 1 cut(s) 49
BtsCI GGATG 4 cut(s) 33, 471, 712, 965
BtsI GCAGTG 2 cut(s) 117, 614
BtsIMutI CAGTG 6 cut(s) 117, 614, 649, 816, 876, 919
Cac8I GCNNGC 4 cut(s) 90, 627, 866, 976
CaiI CAGNNNCTG 1 cut(s) 875
Cfr10I RCCGGY 2 cut(s) 931, 1022
Cfr13I GGNCC 7 cut(s) 108, 150, 273, 287, 293, 305, 713
CseI GACGC 1 cut(s) 608
CsiI ACCWGGT 1 cut(s) 693
CspAI ACCGGT 1 cut(s) 1022
CviAII CATG 5 cut(s) 50, 89, 200, 500, 767
DdeI CTNAG 6 cut(s) 135, 157, 166, 702, 900, 906
DpnI GATC 4 cut(s) 70, 382, 723, 857
DpnII GATC 4 cut(s) 68, 380, 721, 855
EaeI YGGCCR 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 233
Eco130I CCWWGG 2 cut(s) 49, 566
Eco24I GRGCYC 1 cut(s) 235
Eco31I GGTCTC 1 cut(s) 178
Eco53kI GAGCTC 1 cut(s) 233
Eco57I CTGAAG 1 cut(s) 591
EcoICRI GAGCTC 1 cut(s) 233
EcoNI CCTNNNNNAGG 1 cut(s) 375
EcoO109I RGGNCCY 2 cut(s) 150, 273
EcoRII CCWGG 9 cut(s) 64, 97, 289, 301, 307, 376, 421, 693, 985
EcoT14I CCWWGG 2 cut(s) 49, 566
EcoT22I ATGCAT 1 cut(s) 581
EcoT38I GRGCYC 1 cut(s) 235
ErhI CCWWGG 2 cut(s) 49, 566
FaeI CATG 5 cut(s) 53, 92, 203, 503, 770
FaqI GGGAC 1 cut(s) 439
FatI CATG 5 cut(s) 49, 88, 199, 499, 766
FauI CCCGC 1 cut(s) 725
FauNDI CATATG 1 cut(s) 652
Fnu4HI GCNGC 4 cut(s) 86, 534, 801, 995
FokI GGATG 4 cut(s) 20, 478, 719, 952
FriOI GRGCYC 1 cut(s) 235
Fsp4HI GCNGC 4 cut(s) 86, 534, 801, 995
FspBI CTAG 2 cut(s) 753, 998
GluI GCNGC 4 cut(s) 86, 534, 801, 995
GsaI CCCAGC 1 cut(s) 84
GsuI CTGGAG 3 cut(s) 360, 540, 792
HapII CCGG 5 cut(s) 225, 277, 329, 932, 1023
HgaI GACGC 1 cut(s) 608
Hin1II CATG 5 cut(s) 53, 92, 203, 503, 770
HindIII AAGCTT 1 cut(s) 21
HinfI GANTC 2 cut(s) 394, 1036
HpaII CCGG 5 cut(s) 225, 277, 329, 932, 1023
HphI GGTGA 4 cut(s) 257, 381, 499, 921
Hpy188I TCNGA 3 cut(s) 399, 760, 901
Hpy188III TCNNGA 5 cut(s) 183, 320, 588, 667, 859
HpyAV CCTTC 4 cut(s) 186, 246, 408, 936
HpyCH4III ACNGT 3 cut(s) 473, 601, 914
HpyCH4V TGCA 9 cut(s) 88, 92, 494, 533, 579, 629, 800, 814, 828
HpyF10VI GCNNNNNNNGC 6 cut(s) 158, 323, 485, 820, 991, 1013
HpyF3I CTNAG 6 cut(s) 135, 157, 166, 702, 900, 906
Hsp92II CATG 5 cut(s) 53, 92, 203, 503, 770
Kzo9I GATC 4 cut(s) 68, 380, 721, 855
LmnI GCTCC 7 cut(s) 230, 238, 304, 322, 851, 946, 967
Lsp1109I GCAGC 3 cut(s) 72, 545, 812
LweI GCATC 5 cut(s) 219, 313, 588, 638, 994
MabI ACCWGGT 1 cut(s) 693
MaeI CTAG 2 cut(s) 753, 998
MaeIII GTNAC 1 cut(s) 646
MalI GATC 4 cut(s) 70, 382, 723, 857
MboI GATC 4 cut(s) 68, 380, 721, 855
MboII GAAGA 6 cut(s) 51, 171, 231, 271, 348, 597
MfeI CAATTG 1 cut(s) 443
MhlI GDGCHC 3 cut(s) 19, 235, 574
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 5 cut(s) 190, 443, 539, 920, 955
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 2 cut(s) 388, 1030
MmeI TCCRAC 1 cut(s) 873
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 581
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 5 cut(s) 225, 277, 329, 932, 1023
MunI CAATTG 1 cut(s) 443
Mva1269I GAATGC 1 cut(s) 161
MvaI CCWGG 9 cut(s) 66, 99, 291, 303, 309, 378, 423, 695, 987
MvnI CGCG 2 cut(s) 720, 1041
MwoI GCNNNNNNNGC 6 cut(s) 158, 323, 485, 820, 991, 1013
NciI CCSGG 3 cut(s) 225, 277, 329
NcoI CCATGG 1 cut(s) 49
NdeI CATATG 1 cut(s) 652
NdeII GATC 4 cut(s) 68, 380, 721, 855
NlaIII CATG 5 cut(s) 53, 92, 203, 503, 770
NlaIV GGNNCC 3 cut(s) 275, 318, 715
NmuCI GTSAC 1 cut(s) 646
NsiI ATGCAT 1 cut(s) 581
NspI RCATGY 1 cut(s) 92
PaeI GCATGC 1 cut(s) 92
PasI CCCWGGG 1 cut(s) 98
PctI GAATGC 1 cut(s) 161
PfoI TCCNGGA 2 cut(s) 223, 376
PinAI ACCGGT 1 cut(s) 1022
PkrI GCNGC 4 cut(s) 87, 535, 802, 996
Ple19I CGATCG 1 cut(s) 724
PleI GAGTC 2 cut(s) 388, 1030
PpsI GAGTC 2 cut(s) 388, 1030
Psp124BI GAGCTC 1 cut(s) 235
Psp6I CCWGG 9 cut(s) 64, 97, 289, 301, 307, 376, 421, 693, 985
PspFI CCCAGC 1 cut(s) 80
PspGI CCWGG 9 cut(s) 64, 97, 289, 301, 307, 376, 421, 693, 985
PspN4I GGNNCC 3 cut(s) 275, 318, 715
PspPI GGNCC 7 cut(s) 108, 150, 273, 287, 293, 305, 713
PstNI CAGNNNCTG 1 cut(s) 875
PvuI CGATCG 1 cut(s) 724
SacI GAGCTC 1 cut(s) 235
SatI GCNGC 4 cut(s) 86, 534, 801, 995
Sau3AI GATC 4 cut(s) 68, 380, 721, 855
Sau96I GGNCC 7 cut(s) 108, 150, 273, 287, 293, 305, 713
SchI GAGTC 2 cut(s) 388, 1030
SduI GDGCHC 3 cut(s) 19, 235, 574
SexAI ACCWGGT 1 cut(s) 693
SfaNI GCATC 5 cut(s) 219, 313, 588, 638, 994
SfcI CTRYAG 1 cut(s) 936
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
SphI GCATGC 1 cut(s) 92
Sse9I AATT 5 cut(s) 190, 443, 539, 920, 955
SsiI CCGC 3 cut(s) 718, 994, 1041
SspMI CTAG 2 cut(s) 753, 998
SstI GAGCTC 1 cut(s) 235
StyI CCWWGG 2 cut(s) 49, 566
TaaI ACNGT 3 cut(s) 473, 601, 914
TaqI TCGA 2 cut(s) 182, 724
TasI AATT 5 cut(s) 190, 443, 539, 920, 955
TauI GCSGC 1 cut(s) 997
TscAI CASTG 6 cut(s) 124, 621, 649, 816, 876, 919
TseFI GTSAC 1 cut(s) 646
TseI GCWGC 3 cut(s) 85, 533, 800
Tsp45I GTSAC 1 cut(s) 646
TspDTI ATGAA 2 cut(s) 15, 482
TspRI CASTG 6 cut(s) 124, 621, 649, 816, 876, 919
XagI CCTNNNNNAGG 1 cut(s) 375
XceI RCATGY 1 cut(s) 92
XspI CTAG 2 cut(s) 753, 998
Zsp2I ATGCAT 1 cut(s) 581
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.