Rmu_co8264203.1_g000001

Auxin canalisation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8264203.1
OG0006859
Physical Location & Seq
Reverse (-)
1 .. 550
550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8264203.1_g000001.1.cds

Sequence Viewer

Length: 400 bp
atgcatccagaattgaactacaacagctatttccgaaagaaatggctgtcatggaagatagtgccattcaagaacatgtcgatcaagaagtggctgaaggagattaaagaaaggcggaaagaggaacacaggttgcagagagctgaagtccatgcagctatatctatggcaggtgtggcggcagcgcttgctaccattgcggctgaaagctctggaaagaatgagagcactgccaaggaagcagctgtggcttctgcagctgctctggtggcagcccagtgtgcaaaagttgcagaagcaatgggagcaaagaaggaacagatcaacagagtaataggttcagccatgagtagtacaagcgcaagcgatatcttaaccctcacagctgcagctgcaacat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Auxin_canalis PH_2

Protein Analysis

133

Amino Acids

14.32

Weight (kDa)

9.79

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 161
Acc36I ACCTGC 1 cut(s) 161
AciI CCGC 3 cut(s) 115, 179, 200
AcuI CTGAAG 2 cut(s) 116, 165
AfaI GTAC 1 cut(s) 355
AfeI AGCGCT 1 cut(s) 186
AflIII ACRYGT 1 cut(s) 75
AgsI TTSAA 2 cut(s) 16, 70
AluBI AGCT 8 cut(s) 27, 143, 158, 210, 245, 260, 386, 392
AluI AGCT 8 cut(s) 27, 143, 158, 210, 245, 260, 386, 392
Alw21I GWGCWC 1 cut(s) 230
Aor51HI AGCGCT 1 cut(s) 186
ApeKI GCWGC 9 cut(s) 155, 182, 242, 257, 260, 272, 386, 389, 392
AspLEI GCGC 2 cut(s) 187, 362
Bbv12I GWGCWC 1 cut(s) 230
BbvI GCAGC 8 cut(s) 167, 194, 247, 254, 269, 284, 373, 379
BfmI CTRYAG 2 cut(s) 255, 387
BfoI RGCGCY 1 cut(s) 188
BfuAI ACCTGC 1 cut(s) 161
BmrI ACTGGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 13
BmuI ACTGGG 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 234
Bse1I ACTGG 1 cut(s) 277
Bse3DI GCAATG 2 cut(s) 195, 306
BseDI CCNNGG 1 cut(s) 234
BseGI GGATG 1 cut(s) 4
BseMI GCAATG 2 cut(s) 195, 306
BseNI ACTGG 1 cut(s) 277
BseXI GCAGC 8 cut(s) 167, 194, 247, 254, 269, 284, 373, 379
BsiHKAI GWGCWC 1 cut(s) 230
Bsp1286I GDGCHC 1 cut(s) 230
Bsp143I GATC 2 cut(s) 81, 321
BspACI CCGC 3 cut(s) 115, 179, 200
BspMAI CTGCAG 2 cut(s) 259, 391
BspMI ACCTGC 1 cut(s) 161
BsrDI GCAATG 2 cut(s) 195, 306
BsrI ACTGG 1 cut(s) 277
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 2 cut(s) 81, 321
BssT1I CCWWGG 1 cut(s) 234
BstAPI GCANNNNNTGC 2 cut(s) 188, 290
BstC8I GCNNGC 2 cut(s) 189, 364
BstF5I GGATG 1 cut(s) 4
BstH2I RGCGCY 1 cut(s) 188
BstHHI GCGC 2 cut(s) 187, 362
BstKTI GATC 2 cut(s) 84, 324
BstMBI GATC 2 cut(s) 81, 321
BstNSI RCATGY 1 cut(s) 79
BstSFI CTRYAG 2 cut(s) 255, 387
BstV1I GCAGC 8 cut(s) 167, 194, 247, 254, 269, 284, 373, 379
BtsCI GGATG 1 cut(s) 4
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 2 cut(s) 228, 284
BveI ACCTGC 1 cut(s) 161
Cac8I GCNNGC 2 cut(s) 189, 364
CfoI GCGC 2 cut(s) 187, 362
Csp6I GTAC 1 cut(s) 354
CviAII CATG 4 cut(s) 51, 76, 152, 346
CviQI GTAC 1 cut(s) 354
DpnI GATC 2 cut(s) 83, 323
DpnII GATC 2 cut(s) 81, 321
EciI GGCGGA 1 cut(s) 130
Eco130I CCWWGG 1 cut(s) 234
Eco32I GATATC 1 cut(s) 370
Eco47III AGCGCT 1 cut(s) 186
Eco57I CTGAAG 2 cut(s) 116, 165
EcoRV GATATC 1 cut(s) 370
EcoT14I CCWWGG 1 cut(s) 234
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 234
FaeI CATG 4 cut(s) 54, 79, 155, 349
FaiI YATR 6 cut(s) 52, 77, 153, 161, 167, 347
FatI CATG 4 cut(s) 50, 75, 151, 345
GlaI GCGC 2 cut(s) 186, 361
HaeII RGCGCY 1 cut(s) 188
HhaI GCGC 2 cut(s) 187, 362
Hin1II CATG 4 cut(s) 54, 79, 155, 349
Hin6I GCGC 2 cut(s) 185, 360
HinP1I GCGC 2 cut(s) 185, 360
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 4 cut(s) 8, 70, 85, 213
HpyAV CCTTC 2 cut(s) 91, 307
HpyCH4V TGCA 8 cut(s) 4, 136, 155, 257, 284, 293, 389, 395
Hsp92II CATG 4 cut(s) 54, 79, 155, 349
HspAI GCGC 2 cut(s) 185, 360
Kzo9I GATC 2 cut(s) 81, 321
LmnI GCTCC 1 cut(s) 305
LpnPI CCDG 6 cut(s) 21, 115, 156, 198, 251, 290
Lsp1109I GCAGC 8 cut(s) 167, 194, 247, 254, 269, 284, 373, 379
LweI GCATC 1 cut(s) 13
MalI GATC 2 cut(s) 83, 323
MboI GATC 2 cut(s) 81, 321
MboII GAAGA 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 230
MluCI AATT 1 cut(s) 11
MnlI CCTC 2 cut(s) 115, 389
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 105, 374
MspA1I CMGCKG 4 cut(s) 245, 260, 386, 392
NdeII GATC 2 cut(s) 81, 321
NlaIII CATG 4 cut(s) 54, 79, 155, 349
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 79
PaqCI CACCTGC 1 cut(s) 161
PciI ACATGT 1 cut(s) 75
PscI ACATGT 1 cut(s) 75
PstI CTGCAG 2 cut(s) 259, 391
PvuII CAGCTG 4 cut(s) 245, 260, 386, 392
RsaI GTAC 1 cut(s) 355
RsaNI GTAC 1 cut(s) 354
SaqAI TTAA 2 cut(s) 105, 374
Sau3AI GATC 2 cut(s) 81, 321
SduI GDGCHC 1 cut(s) 230
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 2 cut(s) 255, 387
Sse9I AATT 1 cut(s) 11
SsiI CCGC 3 cut(s) 115, 179, 200
StyI CCWWGG 1 cut(s) 234
TaqI TCGA 1 cut(s) 80
TasI AATT 1 cut(s) 11
TatI WGTACW 1 cut(s) 353
TauI GCSGC 2 cut(s) 182, 203
Tru1I TTAA 2 cut(s) 105, 374
Tru9I TTAA 2 cut(s) 105, 374
TscAI CASTG 2 cut(s) 235, 284
TseI GCWGC 9 cut(s) 155, 182, 242, 257, 260, 272, 386, 389, 392
TspRI CASTG 2 cut(s) 235, 284
XceI RCATGY 1 cut(s) 79
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.